Labshake search
Citations for Qiagen :
151 - 200 of 436 citations for 6 n Hexylaminopurine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The N-terminal His-tagged Sif protein (Lmo0946-His6) was expressed and purified using Ni-NTA resin (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: RNA was extracted from SH-SY5Y and SK-N-BE(2) cells using the RNeasy mini kit (Qiagen) following the manufacturer’s protocol including the on-column DNA digestion step ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant both N-and C-terminally His-tagged proteins were purified using a Ni-NTA Superflow cartridge (1ml, Qiagen) and the Fast Protein Liquid Chromatography (FPLC ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from P15 liver tissue (n=4 biological replicates per strain) using QIAzol Lysis Reagent (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Bacterial genomic DNA was extracted from overnight (o/n) bacterial liquid cultures with DNeasy® Blood & Tissue Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP ± MirA was loaded onto a column with 80 µL of previously equilibrated Ni-NTA resin (Qiagen) and incubated for 1 h at 4°C with agitation ...
-
bioRxiv - Genomics 2021Quote: ... total RNA was isolated from patient blood samples (CD19+ presorted n=161) using the RNA RNeasy mini kit (Qiagen). RNA quantification was performed with a Qubit 2.0 Fluorometer ...
-
bioRxiv - Cancer Biology 2022Quote: RNA from Nestin(N)/tv-a;Ink4a/Arf-/- neural progenitors was isolated using the RNeasy Kit (Qiagen, Catalog# 74104) and 1μg of total RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... viral RNA was extracted from AFs stocks using the QIAamp MinElute Virus Spin kit (cat. n° 57704, Qiagen, Germany), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... was transformed with an N-terminally His-tagged fusion protein of cytHPPK/DHPS (At1g69190) in the vector pQE30 (Qiagen). Overnight cultures grown at 30°C in LB broth supplemented with 35 µg/mL kanamycin and 100 µg/mL ampicillin were sub-cultured to an OD600 of 0.6 - 0.7 and induced overnight at 16°C with 100 mM isopropyl β-D-1-thiogalactopyranoside ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... of vehicle and Acyl-GIP vehicle treated LDLR−/− mice (n = 5) using Qiazol according to the manufacturer’s instructions (Qiazol Lysis Reagent, QIAGEN). The quality of the RNA was determined with the Agilent 2100 BioAnalyzer (RNA 6000 Nano Kit ...
-
bioRxiv - Microbiology 2022Quote: ... N-terminal His-tagged SlPR1 and SlChi3 proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA extraction of gill tissue (N = 16 individuals per population) was performed using the DNeasy Blood & Tissue Kit (Qiagen). Further purification of the extracted DNA was done with NucleoSpin® gDNA Clean-up (Macherey-Nagel) ...
-
bioRxiv - Microbiology 2019Quote: Initial N-gene amplicon analysis was performed with 0.2 μl Round 2 product using the QIAxcel (Qiagen, Hilden, Germany). For positive reactions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Those PDTOs that underwent FOLFOX treatment (n=14) had RNA extracted using the Qiagen RNAeasy micro kit (Qiagen, # 74004).
-
bioRxiv - Microbiology 2020Quote: Following 72 h post treatment with a sublethal concentration of compound 33 (3.13 µM), adult male worms (n = 20 worms, three biological replicates) were homogenized with a TissueLyser (Qiagen) and total histones extracted using the EpiQuikTM Total Histone Extraction kit (OP-0006 ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was isolated from dissected brains (n = 9 brains per experimental cohort) by RNeasy Mini Kit (Qiagen, 74104), with on-column removal of genomic DNA (Qiagen ...
-
bioRxiv - Immunology 2023Quote: RNAseq was performed on total PBMCs from n=36 individuals in our cohort using the AllPrep kit as per manufacturer’s instructions (Qiagen). RNA libraries ...
-
bioRxiv - Microbiology 2020Quote: ... vIL-6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using QuantiTect Multiplex RT-PCR Kits (Qiagen) as described previously (37 ...
-
bioRxiv - Neuroscience 2020Quote: ... Amplified fragments were sequenced (Secugen S.L., Madrid) and analysed using CLC Sequence Viewer 6 (Qiagen).
-
bioRxiv - Molecular Biology 2022Quote: ... for 6 h at 55 °C followed by purification with a Qiaquick PCR Kit (Qiagen). Libraries were prepared using a MicroPlex Library Preparation Kit (Diagenode ...
-
bioRxiv - Genetics 2022Quote: ... Cells were transfected in 6-well plates at 80% confluency using Effectene transfection reagent (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 5 or 6 Transwells using the RNeasy Micro Plus kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA (at least from 2.5* 10^6 cells) was purified onto RNeasy columns (Qiagen) and treated on-column with DNase (Qiagen) ...
-
bioRxiv - Plant Biology 2022Quote: ... and 6 days after being transferred into SIM medium using miRNeasy Mini Kit (QIAGEN, 217004). High-quality RNA was used to prepare sequencing libraries with the MGIEasy RNA library preparation kit ...
-
bioRxiv - Immunology 2020Quote: ... Gene specific primers for IL-6 (Hs_IL6_1_SG QuantiTect Primer Assay) was sourced from QuantiTect (Qiagen) primers ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-6 cryosections were also collected for RNA extraction using RNAeasy Micro kit (Qiagen, 74004). Quality of the RNAs was determined by Tapestation (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from cells in 6 cm dishes using the RNeasy kit (Qiagen # 74106) according to manufacturer instructions ...
-
bioRxiv - Immunology 2022Quote: ... corpus (segment 6-7) and cauda (segment 8-10) samples using QIAzol Lysis Reagent (Qiagen) following the manufactureŕs recommendation using a bead-based tissue homogenizer (Retsch ...
-
bioRxiv - Molecular Biology 2023Quote: S2 cell transfections were carried out in 6-well plates using Effectene transfection reagent (Qiagen). Each well was transfected with 1 μg of the pAc5.1-λN-HA:dFMRP and 1 μg pAFW-AGO1 or pAFW-GW182 plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: S2 cell transfections were carried out in 6-well plates using Effectene transfection reagent (Qiagen). Each well was transfected with 1 μg of the pAc5.1-EGFP:dFMRP and 1 μg of pAc5.1-mCherry plasmids containing DCR1 ...
-
bioRxiv - Microbiology 2023Quote: Lungs from hamsters at 4 or 6 dpi were homogenized in PBS with TissueRuptor (Qiagen). A part of the whole lung homogenate was subjected to plaque assays for virus titration as described above ...
-
bioRxiv - Immunology 2023Quote: ... muris isolates (6 in total) were extracted via a DNeasy Blood and Tissue kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with guide RNAs for Rme-6 knockdown using Polyfect Transfection reagent (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: 2 × 105 cells were reverse-transfected in 6-well plates with Flexitube siRNA constructs (Qiagen) targeting KEAP1 (KEAP1_5 or KEAP1_8) ...
-
bioRxiv - Cell Biology 2023Quote: ... High speed supernatant was combined with 6 mL of Ni-NTA Agarose (Qiagen, Cat# 30230) and stirred in a beaker for 1-2 hour(s ...
-
bioRxiv - Microbiology 2024Quote: ... 1.5x105 Acanthamoeba castellanii cells were transfected with 6 μg of linearized plasmid using Polyfect (QIAGEN) in phosphate saline buffer (PBS) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was extracted from appropriately staged embryos or whole larvae (n=10 /sample) using the RNeasy Plus Universal mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from heparinised blood of SI and SH mice (n=3 per housing group) using the RNeasy Protect Animal Blood Kit (Qiagen). Extracted RNA was hybridised at UCL genomics following standard Affymetrix protocols ...
-
bioRxiv - Genetics 2021Quote: ... 12 WT littermates) and two-month-old mice (adult, n = 4 per group) were lysed and homogenized in QIAzol Lysis Reagent (Qiagen). Total RNA purification was performed with the miRNeasy Micro Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: Whole blood samples from 10 healthy volunteers (n = 5 females and n = 5 males) aged from 25 to 37 were collected into PAX gene RNA blood tubes (Qiagen). Total RNA samples were isolated using QIAcube automation with the PAXgene Blood miRNA Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... PRRSV-2 RNA was used to amplify cDNA encoding the full-length of N gene by RT-PCR (One-step RT-PCR, QIAGEN) using specific primers with the forward containing a T7 promoter sequence at the 5’ end ...
-
bioRxiv - Microbiology 2019Quote: ... coli BL21 (DE3) as fusion proteins containing an N-terminal His6- tag and purified by immobilized metal-affinity chromatography (Ni-NTA, Qiagen). Full-length DosR was also expressed with N-terminal GST-tag ...
-
bioRxiv - Immunology 2021Quote: ... Copies of SARS-CoV-2 nucleocapsid (N) gene in homogenized tissues were determined using QuantiNova SYBR Green PCR kit (Qiagen) along with 2019-nCoV RUO Kit (Integrated DNA Technologies ...
-
bioRxiv - Microbiology 2020Quote: DNA extractions from the 8-week fecal samples (n = 8 per group) were performed using the Qiagen QIAmp DNA stool extraction kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA from ∼250,000 neurons per sample (n = 3 samples per group) was extracted and purified (DNeasy Blood and Tissue DNA extraction kit, Qiagen) prior to RRBS (Ovation RRBS Methyl-Seq System ...
-
bioRxiv - Biophysics 2020Quote: ... All the constructs also contain a His6-tag at the N-terminus for affinity purification with Nickel-NTA agarose beads (Qiagen). Site-directed mutagenesis was performed using the QuickChange Lightning kit (Agilent Technology) ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was isolated from 3D samples (n=2-3) by combining a TRIzol-based cell lysis with a RNeasy Mini Kit (Qiagen). Samples were collected at aforementioned timepoints ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant protein fragments were produced in Escherichia coli (strain M15) as fusion products with an N-terminal tag of six histidines using plasmid pQE30 (Qiagen) and purified from total bacterial lysates by nickel affinity chromatography ...