Labshake search
Citations for Qiagen :
501 - 550 of 4054 citations for 6 methyl 4 oxo N phenyl 2 3 dihydro 1 4 oxathiine 5 carboxamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: Total DNA was isolated from 2-3 weeks old seedlings with DNeasy Plant Mini Kit (QIAGEN). 1ng of DNA per qPCR reaction was used as template ...
-
bioRxiv - Molecular Biology 2022Quote: Two independent siRNAs targeting YBX1 (Hs_YBX1-1 and Hs_YBX1-6 FlexiTube siRNA, Qiagen) and a non-targeting negative control siRNA (AllStars ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from frozen mouse liver (20-25 mg) and HepG2 cells (5-6 million) using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... placed into a 2 mL tube with 600 μL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989), then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Physiology 2020Quote: ... DNA was isolated using Qiagen MagAttract PowerMicrobiome kit DNA/RNA kit (Qiagen, catalog no. 27500-4-EP) on the EpMotion 5075 (Eppendorf ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from pure cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4) or DNeasy Blood and Tissue Kit (Qiagen 69504 ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted from 4 mg of ground lyophilized material using the RNeasy Midi kit (Qiagen). A DNase treatment (Ambion ...
-
bioRxiv - Cancer Biology 2022Quote: Cell pellets or pieces of xenografts were lysed in 4% SDS buffer using a QIAshredder (Qiagen, 79654). See Supplementary Table S1 for antibodies used ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was isolated from 4×107 KPC cells using the Blood & Cell Culture DNA Maxi Kit (Qiagen). NGS libraries were prepared using the following primers:
-
bioRxiv - Microbiology 2020Quote: ... RNA extraction was performed from homogenate of 4 mg of lung tissue with RNeasy Mini Kit (Qiagen), or 50µl of serum using the NucleoSpin kit (Macherey-Nagel) ...
-
bioRxiv - Immunology 2022Quote: ... 97-mer shRNA oligonucleotides were synthesized (IDT) and 4 picomoles were amplified with HotStarTaq polymerase (Qiagen#203207) using the primers miR-E-fw (5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The plates were coated with 100 μL of 4 μg/mL murine anti-His mAb (Qiagen, #34660), and after blocking ...
-
bioRxiv - Pathology 2021Quote: ... at 4°C and total RNA was extracted with the RNeasy Midi kit (Qiagen, Santa Clarita, CA). Mouse Genome 430A 2.0 arrays (Affymetrix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Samples were kept at 4° for two days before extracting DNA using the DNeasy PowerSoil Kit (Qiagen). We also obtained DNA extracted from ...
-
bioRxiv - Genomics 2021Quote: ... sativa seedlings (∼1.5 weeks) and mature leaves (∼4 weeks) using the DNeasy Plant Mini kit (Qiagen #69104) and diluted to 5 ng/μl ...
-
bioRxiv - Immunology 2020Quote: 4 matched pairs of Treg and MulTreg were expanded and RNA extracted (RNeasy RNA extraction kit, Qiagen). cDNA was then produced (SMART cDNA synthesis kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... 565 E.coli colonies per guide ratio (>500x coverage) was used to process the 4 Maxi-Prep (Qiagen) reactions ...
-
bioRxiv - Biochemistry 2022Quote: ... 4°) and plasmids were extracted from the cell pallets using QIAprep Spin Miniprep kit (Qiagen, CA, USA). The sequences of the inserts were confirmed by Sanger sequencing (ACGT Inc ...
-
bioRxiv - Immunology 2022Quote: ... After mechanical disruption by shaking at 25/s over 4 min with metal beads (TissueLyser II, Qiagen), two 250 μL aliquots of the homogenate were stored at -80°C for viral plaque titration ...
-
bioRxiv - Plant Biology 2022Quote: ... the clear supernatant was incubated for 4 h with 1.5 ml Ni-NTA agarose (Qiagen, Hilden, Germany) previously washed with 6 ml of distilled H2O and equilibrated with 6 ml of binding buffer (150 mM NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... Four wells were then harvested at the appropriate growth stage and combined with 4 mL RNAprotect (Qiagen) to generate each replicate ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was extracted from pure cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen 10196-4) or DNeasy Blood and Tissue Kit (Qiagen 69504 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cleared lysate was applied to 4 ml bed volume Ni-NTA Agarose beads (Qiagen, cat. No. 30210) for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of field-saturated peat were added to 2.5 volumes of Lifeguard buffer (Qiagen, Maryland, USA), transferred out of the field on ice in a cooler ...
-
bioRxiv - Biochemistry 2023Quote: ... The harvested cells of TonAmyGT and Chimera 4 were re-sususpended with non-denaturing lysis buffer (Qiagen) and 0.2 % of Sarcosyl and kept overnight for re-suspension ...
-
bioRxiv - Microbiology 2023Quote: ... aureus and 4 food-derived Staphylococcus bacteria were extracted using the DNeasy 96 Blood & Tissue kit (Qiagen). For sequencing analysis ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was collected 4 days post lentiviral shRNA transduction using RNeasy Plus Mini Kit (Qiagen #74134). Lentiviral transduction and RNA extraction were performed in triplicates ...
-
bioRxiv - Biochemistry 2023Quote: ... Affinity chromatography was carried out at 4°C with a Ni-NTA sepharose column (Qiagen, Hilden, Germany). The column was pre-equilibrated with 50 mM NaH2PO4-buffer pH 7.6 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Labchip analysis was performed to assess the size of small RNAs according manufacturer’s instructions (PerkinElmer).The Reverse transcription was performed on 4 ng RNA using miRCURY® LNA® RT Kit (Qiagen). Real-time quantitative PCR was performed on 40 pg cDNA using specific primers (Supplementary Table 1 ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Microbiology 2020Quote: ... and 6.25mL 2-mercaptoethanol (βME)) and homogenized at 30Hz for 3 min in a TissueLyzer II (Qiagen). 60 μL of 100% isopropanol was added to each tube and incubated for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from pools of 2-3 organoids using RNeasy Plus Mini Kit (Qiagen, #74134) according to the manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells in 6-well plates were transfected with 2 μg pIRES2-eGFP or Trim-HA-NUP153 derivatives using Effectene (Qiagen). At 24 h post-transfection ...
-
bioRxiv - Biochemistry 2022Quote: 3×106 cells from the day 8 of CD34+ HSPC and day 6 of HUDEP-2 erythroid differentiation were used for total RNA using RNeasy Mini Kit (Qiagen). For reverse transcription using Primescript RT reagent kit (Takara Bio Inc.) ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131) overnight ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 (2×106 cells/well) using the RNeasy Mini Kit (Qiagen) with DNase I treatment to eliminate DNA contaminants as previously described18 ...
-
bioRxiv - Microbiology 2023Quote: Cellular RNA of 2-5×105 cells was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were lysed (1.28 M sucrose, 40 mM Tris-HCl [pH 7.5], 20 mM MgCl2, and 4% Triton X-100; Qiagen) and digested (800 mM guanidine–HCl ...