Labshake search
Citations for Qiagen :
351 - 400 of 2436 citations for 6 methyl 3 oxo 2 3 dihydropyridazine 4 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... benthamiana leaves were grinded in a tube with two glass beads (3 mm) with a TissueLyser II (Qiagen) and directly after supplied with 600 μl EB ...
-
bioRxiv - Microbiology 2019Quote: ... RNA samples from 3 independent cultures for each strain (Chr_dam and Chr_gfp) were extracted with RNeasy miniprep kit (Qiagen). Primers used are listed in Table S1 ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from an aliquot of 3 x 106 cells using the RNeasy Plus Kit (Qiagen). cDNA was synthesized from extracted RNA using the iScript cDNA Synthesis Kit (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... genomic DNA was isolated from HEK293T cells 3 days after transfections using the Gentra Puregene Cell Kit (Qiagen) and was diluted to 10 ng/μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed 3 times with PBS and had their genomic DNA extracted with the QIAamp DNA mini kit (QIAGEN). Sequencing libraries were prepared at GenomeScan (Netherlands ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from 0 or 3% CSE-treated bronchospheres using the Qiagen RNeasy Mini Kit (Qiagen 74106). The RNA yield was measured using Agilent TapeStation (4200 TapeStation System ...
-
bioRxiv - Microbiology 2023Quote: ... Individual mosquitoes were homogenized for 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). DNA extraction of individual larvae was carried out using the QIAamp DNA Kit (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: ... Genomic DNA was extracted from 3-week-old plants using the DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from 3 dpf zebrafish AB larvae (50 fish) using RNAeasy Plus Kit (Qiagen 74134). cDNA was synthesized using SuperScript IV Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCR was performed in an Applied Biosystems QuantStudio 3 using the QuantiTect® Multiplex PCR Kit (QIAGEN). The primers and probes used are listed in Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: siRNA targeting human GPRC5A (siGPRC5A_4 against target sequence 5′-CTGGGTGTGTTGGGCATCTTT-3′, cat# SI04438021) and non-targeting control siRNA (cat# Ctrl_AllStars_1, target sequence not disclosed) were purchased from Qiagen. Human primary keratinocytes were transfected at 20 nM final siRNA concentration using Lipofectamin 2000 reagent (Life Technologies ...
-
bioRxiv - Genetics 2023Quote: ... Total RNA was then isolated for each biological replicate (3) using an RNeasy Lipid Tissue Mini kit (Qiagen). DNA contamination was removed using TURBO DNA-free (Ambion) ...
-
bioRxiv - Genomics 2024Quote: ... with two 3 mm metal beads and ground into a fine powder with a TissueLyser II (Qiagen, Germany) at 30 Hz for 2 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNAs were isolated from 6-month H19ΔICR/H19ΔICR and H19+/H19+ littermates (2 per genotype) using RNeasy Plus Mini Kit (Qiagen). Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina) ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mL of fermentor culture was added to 4 mL RNAprotect Bacteria Reagent (Qiagen) and immediately vortexed for 10 sec ...
-
bioRxiv - Microbiology 2024Quote: ... resuspended in 2 mL salts mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen), and then incubated for 5 min at room temperature for stabilization before centrifugation at 4000 rpm for 10 min ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from the leaves of 4-to-6-week old plants using the RNeasy Plant Mini Kit (Qiagen). RNA concentrations were quantified using a Qubit RNA BR Assay Kit (ThermoFisher ...
-
bioRxiv - Plant Biology 2021Quote: ... We extracted total RNA from 10 leaves that were shorter than 500 µm and from 4–6 mature leaves using the RNeasy Micro Kit (Qiagen) and the RNeasy Plant Mini Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was isolated from liver and lung tissues (n=4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Mini Kit (Qiagen) and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group ...
-
bioRxiv - Cancer Biology 2021Quote: ... and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Blood Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 250 to 1000 μm lengths of epithelium sections were microdissected from 4 to 6 successive serial sections and DNA extracted using a QIAMP DNA microkit (Qiagen) by digesting overnight and following manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and 3-week-old) and leaves (4-, 5-, and 6-week-old plants) was isolated and purified using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... diluted in fresh culture media or left untreated (n = 4) for 6 h prior to harvesting RNA in RLT buffer (Qiagen) with added β-ME ...
-
bioRxiv - Biophysics 2021Quote: cfDNA was isolated from 2 mL of plasma for each sample via the QIAamp Circulating Nucleic Acid kit (Qiagen). ddPCR was performed using the QX200 Droplet Digital PCR System (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2020Quote: ... we differentiated human stem cells for 3 days in mTeSR + 0.5 µM A8301 and extracted RNA with RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic DNA from 3×107 sorted GFP+ cells was extracted using the Blood & Cell Culture DNA Maxi Kit (Qiagen). Amplification of sgRNA regions from the extracted genome and the original sgRNA plasmid library ...
-
bioRxiv - Molecular Biology 2020Quote: ... while method-3 was a modified protocol of the DNeasy PowerMax Soil Kit (Cat.No. 12988-10) provided by Qiagen (based on communication exchanged with the manufacturer) ...
-
bioRxiv - Cell Biology 2019Quote: Transduced GFP+ LT-HSCs from 3 independent biological replicates were sorted directly into 350 ul of RLT buffer (Qiagen). Total RNA was isolated from cells using the RNeasy Micro kit (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was purified from cell passage number 3 using the RNeasy RNA purification kit (Qiagen Cat. No. 75142). A260:280 ratio > 2 and RIN > 9.
-
bioRxiv - Immunology 2021Quote: Bacterial plasmid DNA was extracted from a 3 ml overnight culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Next ...
-
bioRxiv - Microbiology 2020Quote: Each dissected compartment (legs and thoraxes) was homogenized individually 3 x 1 minute at 30 Hertz using TissueLyser (Qiagen) and glass beads (#11079110 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Tissue samples were homogenized in 3 mL sterile PBS for 20 seconds on ice using a TissueRuptor homogenizer (Qiagen) with sterile tips ...
-
bioRxiv - Genomics 2022Quote: ... 50 ng of total RNA was processed up to 3’ adapter ligation step according to the manufacturer’s instruction (Qiagen). The adapter-ligated RNA was treated with 5U of RppH (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted at 3 hpi and 24 hpi with the RNeasy Mini Total RNA extraction kit (Qiagen). SARS-CoV-2 RNA was detected with the CDC assay kit (IDT ...
-
bioRxiv - Bioengineering 2022Quote: ... transfected cells were harvested on Day 3 and genomic DNA was extracted using DNeasy Blood & Tissue Kit (QIAGEN # 69506). The region surrounding EMX1 target site was amplified with EMX1-F ...
-
bioRxiv - Neuroscience 2021Quote: ... miR-67 (miR control) or empty vector at a ratio of 1:3 using a lipofection protocol (Effecten, Qiagen) and processed at DIV15 ...
-
bioRxiv - Cell Biology 2019Quote: ... accordingly to manufacturer’s instructions using non-targeting siRNA (siCtrl; 5’-AATTCTCCGAACGTGTCACGT-3’) and siRNA targeting Cav1 (SI00299635 and SI00299628) from Qiagen, or using pre-miR-NC (negative control ...
-
bioRxiv - Developmental Biology 2019Quote: ... The TSB (5’-ATTATTGCACCCAGTGCC-3’: the miR-92a-3p target site is underlined) was designed and produced by Qiagen, with an additional scrambled TSB to act as a negative control (5’-TAACACGTGTATACGCCCA-3’) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNAs from batch of 3-5 embryos were extracted with the Rneasy® Micro Kit (Qiagen, Valencia CA). Relative quantitative PCR was performed on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2019Quote: ... Input material (total cytoplasmic mRNA) and efficiently translated mRNA (heavy polysome-associated, >3 ribosomes) were extracted with QIAzol (Qiagen) and purified using RNeasy MinElute Cleanup Kit (Qiagen) ...
-
bioRxiv - Genetics 2020Quote: ... Seedlings of 3-week-old plants were used to extract total RNAs using the RNeasy Plant Mini Kit (Qiagen). Total RNAs were treated with amplification-grade RNase-free DNase I (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Individual tumors were collected in low binding DNA tubes and digested in 3 μl RLT buffer (Qiagen Cat# 1048449) for 30min at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Sample tubes were transferred back to ice before 3 rounds of 60 second bead beating on the TissueLyser2 (Qiagen). Samples were incubated at room temperature for five minutes before 200 µL of chloroform (Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were harvested 3 days later by direct application of buffer RLT from the RNeasy mini kit (Qiagen 74104).
-
bioRxiv - Microbiology 2022Quote: ... homogenized in 500 μl PBS by bead beating (3 mm steel ball, 25 Hz for 2.5 min in a TissueLyser (Qiagen)) ...
-
bioRxiv - Plant Biology 2022Quote: 3 μg total RNA was extracted from each flower bud sample using Tiangen Polysaccharide and Polyphenol Kit (QIAGEN, Germany). After passing the quality inspection ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA was extracted from 50-80 mg of surface-sterilised (70% EtOH, 0.1% Triton X-100) and 3-days germinated seeds with RNeasy Mini kit (Qiagen) according to the manufacturer’s protocol ...