Labshake search
Citations for Qiagen :
101 - 150 of 2450 citations for 6 cyano 5 methoxy 12 methylindolo 2 3 a carbazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... RNAs were isolated from 6-month H19ΔICR/H19ΔICR and H19+/H19+ littermates (2 per genotype) using RNeasy Plus Mini Kit (Qiagen). Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina) ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was extracted from cells grown in five different salinity treatments (0, 2, 12, 24, 36 parts per thousand) using the RNeasy Plant Kit (Qiagen), and 15 Illumina libraries were prepared using the Kapa mRNA HyperPrep kit and sequenced on the Illumina HiSeq2000 platform at the Beijing Genomics Institute.
-
bioRxiv - Physiology 2022Quote: Assessment of differential expression was conducted on the mapped reads of the 2 previously mentioned pipelines using 2 methods for comparison: the EDGE method with default settings in CLC Genomics Workbench 12 (QIAGEN) and EdgeR (version 3.34.0) ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA of subclones from a 12-well plate along with 2 million parental cells were extracted using DNeasy Blood & Tissue Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Immunology 2019Quote: ... approximately 25 mg of tissues were homogenized in 2 mL tubes containing 600 μL of Buffer RLT with 2% β-mercaptoethanol and a stainless steel bead (5 mm, Qiagen) using a TissueLyser II system (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... 12 µL of Enhancer (Qiagen), 16 µg of plasmid and 15 µL of Effectene (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... matching a sequence in intron 22 of the HTT gene (5’-TAATACGTAAGTGTCACAA-3’, custom synthesized by Qiagen) was delivered by intracerebroventricular (ICV ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from pools of 3-5 second leaves using the Plant RNAeasy kit (Qiagen) using manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... cells pooled from n = 3 - 5 mice / cohort) was isolated using the RNeasy Plus Mini Kit (Qiagen). Clariom S microarray analysis (Affymetrix ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was then purified by mixing with beads at a 1:0.6 DNA/beads ratio followed by 3 washes with 70% ethanol and eluted with 30 μl of elution buffer (Qiagen Cat# 19086). Whole-exome sequencing was performed using the Mouse_Exome_Targets baitset from the Wellcome Sanger Institute pipeline ...
-
bioRxiv - Plant Biology 2020Quote: Total DNA was isolated from 2-3 weeks old seedlings with DNeasy Plant Mini Kit (QIAGEN). 1ng of DNA per qPCR reaction was used as template ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from frozen mouse liver (20-25 mg) and HepG2 cells (5-6 million) using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... and 3-week-old) and leaves (4-, 5-, and 6-week-old plants) was isolated and purified using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Neuroscience 2020Quote: ... RAGE-/- and SOD1G93A x RAGE-/- mice (n = 5 - 6) using RNeasy Lipid Tissue extraction kit according to manufacturer’s instructions (QIAGEN, CA, USA). The total RNA was purified from genomic DNA contamination using Turbo DNase treatment (Ambion ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... trigynum (Sample size: L. tenue thrum=6, pin=4, L. trigynum homostyle=5) using the RNeasy Plant Mini Kit (QIAGEN, Germany). Libraries were sequenced on an Illumina NovaSeq S1 Sequencing System to produce paired-end 150bp read length reads ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Microbiology 2020Quote: ... and 6.25mL 2-mercaptoethanol (βME)) and homogenized at 30Hz for 3 min in a TissueLyzer II (Qiagen). 60 μL of 100% isopropanol was added to each tube and incubated for 1 min ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from pools of 2-3 organoids using RNeasy Plus Mini Kit (Qiagen, #74134) according to the manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells in 6-well plates were transfected with 2 μg pIRES2-eGFP or Trim-HA-NUP153 derivatives using Effectene (Qiagen). At 24 h post-transfection ...
-
bioRxiv - Biochemistry 2022Quote: 3×106 cells from the day 8 of CD34+ HSPC and day 6 of HUDEP-2 erythroid differentiation were used for total RNA using RNeasy Mini Kit (Qiagen). For reverse transcription using Primescript RT reagent kit (Takara Bio Inc.) ...
-
bioRxiv - Neuroscience 2021Quote: ... 3-5 μg of DNA was isolated from frozen cortex of 2- and 12-month-old mice according to the manufacturer’s protocol (DNeasy Blood & Tissue Kit, Qiagen, Cat No. 69504) and diluted with 10 mM Tris ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131) overnight ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 (2×106 cells/well) using the RNeasy Mini Kit (Qiagen) with DNase I treatment to eliminate DNA contaminants as previously described18 ...
-
bioRxiv - Microbiology 2023Quote: Cellular RNA of 2-5×105 cells was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... and CLC Genomics Workbench 12 (Qiagen) all program arguments available in GitHub repository ...
-
bioRxiv - Microbiology 2020Quote: ... CLC Genomics Workbench version 12 (Qiagen) was used to de novo assemble WT ATCC 700057 ...
-
bioRxiv - Systems Biology 2022Quote: ... Ten millilitres of culture were pelleted by immediate centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Cell Biology 2019Quote: ... accordingly to manufacturer’s instructions using non-targeting siRNA (siCtrl; 5’-AATTCTCCGAACGTGTCACGT-3’) and siRNA targeting Cav1 (SI00299635 and SI00299628) from Qiagen, or using pre-miR-NC (negative control ...
-
bioRxiv - Developmental Biology 2019Quote: ... The TSB (5’-ATTATTGCACCCAGTGCC-3’: the miR-92a-3p target site is underlined) was designed and produced by Qiagen, with an additional scrambled TSB to act as a negative control (5’-TAACACGTGTATACGCCCA-3’) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNAs from batch of 3-5 embryos were extracted with the Rneasy® Micro Kit (Qiagen, Valencia CA). Relative quantitative PCR was performed on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Cell Biology 2019Quote: ... Transient transfections were carried out using just subconfluent cultures in 35 mm plates or in wells of a 6-well plate using DNA in the range of 0.3-2 µg/culture and the Polyfect reagent (Qiagen, Germantown, MD) and the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Immunology 2023Quote: ... in vitro derived Foxp3+ cells were harvested on day 2 and day 6 into Trizol and total RNA was isolated with miRNeasy Micro Kits (QIAGEN 217084) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Genetics 2019Quote: ... for lysis in 2 ml safe-lock tubes containing one 5 mm stainless steel bead (Qiagen) for 2.5-3 minutes at 30 Hz using TissueLyzer II (Qiagen) ...