Labshake search
Citations for Qiagen :
1 - 50 of 1500 citations for 6 chloro 9H 3 C methyl β D ribofuranosyl purine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Cancer Biology 2020Quote: ... Epitect Methyl II PCR Array System (Qiagen) was used to determine the CpG island methylation status of CDH1 (E-Cadherin) ...
-
bioRxiv - Neuroscience 2022Quote: EpiTect Methyl II PCR Primer Assay (Qiagen) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... coli strains expressing (His)6-Clr4 and (His)6-Swi6 and allowed to bind at 4°C overnight to Ni-NTA resin (Qiagen; binding capacity 5-10mg protein/ml resin) ...
-
bioRxiv - Microbiology 2021Quote: ... IL-6 and β-actin cDNA were determined by QuantiFast SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) at the conditions ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 mL of culture were mixed with 6 mL of RNAprotect bacteria reagent (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Microbiology 2020Quote: ... vIL-6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using QuantiTect Multiplex RT-PCR Kits (Qiagen) as described previously (37 ...
-
bioRxiv - Molecular Biology 2022Quote: ... for 6 h at 55 °C followed by purification with a Qiaquick PCR Kit (Qiagen). Libraries were prepared using a MicroPlex Library Preparation Kit (Diagenode ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
Dimeric prion protein ligand activates Adgrg6 but does not rescue myelinopathy of PrP-deficient micebioRxiv - Neuroscience 2020Quote: ... The temperature was increased from 25 °C to 95 °C at 3 °C per minute and fluorescence was measured at 610 nm in a Rotor-Gene Q thermocycler (Qiagen). The experiment was performed in technical triplicates ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNAs were purified from 3 mL overnight cultures grew at optimum temperature (30 °C or 37 °C) by Dneasy Blood & Tissue Kits (QIAGEN). Additionally ...
-
bioRxiv - Biochemistry 2023Quote: ... the EcNhaA triple mutant was extracted from membranes with n-Dodecyl β-D-maltoside (DDM; Glycon) and purified by Ni-nitrilotriacetic acid (Ni-NTA; Qiagen) affinity chromatography ...
-
bioRxiv - Microbiology 2022Quote: ... 3 mL samples were added to tubes containing 6 mL RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and vortexed ...
-
bioRxiv - Molecular Biology 2021Quote: ... was induced by adding isopropyl β-D-1-thiogalactopyranoside (IPTG) into the LB media and purified by Ni-NTA affinity chromatography (Qiagen, USA). The full length of ASSCP2 protein (ASSCP2-R ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: 3-10k cells were FACS sorted into buffer RLT with β-mercaptoethanol and total RNA prepared using RNAeasy Micro (Qiagen) with on column DNase I treatment ...
-
bioRxiv - Cancer Biology 2021Quote: ... a cancer associated fibroblast (CAF) cell line (pCAF2) expressing TGF-β responsive SMAD2/3/4 RE-Luciferase (Qiagen, #CLS-017L) was created ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were incubated for 3 minutes at 56°C in a deparaffinization solution (Qiagen, 19093). A step of digestion with Proteinase K was performed followed by a treatment with DNAses ...
-
bioRxiv - Immunology 2020Quote: ... harvested and stored at −80°C in RLT buffer with β-mercaptoethanol from the RNeasy Mini prep Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions until cDNA synthesis for RT2 Profiler PCR array ...
-
bioRxiv - Immunology 2020Quote: ... Pellets were lysed by vortexing for 1 minute in 350uL cold supplemented RLT buffer (RLT + β-MeOH) at 4°C and lysates homogenized using QIAshredder columns (Qiagen). RNA was then extracted from these samples using the RNeasy Plus Micro kit (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Microbiology 2021Quote: ... for 30 minutes at 37°C followed by beadbeating with 50μg 0.1mm zirconium beads for 6 minutes on the Tissuelyzer II (Qiagen) prior to loading onto the Qiacube HT ...
-
bioRxiv - Genetics 2022Quote: ... 3 min in 37°C shaker) and processed with DNeasy Blood and Tissue Kit (QIAGEN #69504). Two hundred ng of genomic DNA was used as input in the DamID protocol that included an improved pool of AdR primers as described (de la Cruz Ruiz et al ...
-
bioRxiv - Developmental Biology 2020Quote: RNA was extracted from 3 dpf and 6 dpf cdipt mutant zebrafish and their wildtype siblings using RNAeasy (Qiagen). RNA samples were reverse transcribed into cDNA using the iScript cDNA synthesis kit (BioRad) ...
-
bioRxiv - Systems Biology 2023Quote: ... A culture volume equal to 3 mL of OD = 1 was added to 6 mL RNAprotect Bacteria Reagent (Qiagen), vortexed ...
-
bioRxiv - Microbiology 2021Quote: ... 6 (Qiagen) for additional analysis ...
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... Transcripts were stabilized by mixing 3 mL of cell cultures at the mid-log phase with 6 mL of RNAprotect Bacteria Reagent (Qiagen). Samples were immediately vortexed for 5 sec ...
-
bioRxiv - Immunology 2022Quote: ... A549-ORF7a and A549-ORF7b cells were seeded (3×10E5) in 6-well plates and lysed using RLT buffer for RNA isolation (RNeasy mini kit, Qiagen). Each sample was performed in triplicate ...
-
bioRxiv - Developmental Biology 2020Quote: E9.5 hindbrain spanning rhombomeres 1-6 were dissected from wild type and mutant embryos (n=3) to obtain total mRNA preparations (miRNeasy Micro Kit, Qiagen). Sequencing libraries were prepared following the SMART-Seq v4 Ultra Low Input RNA (TaKaRa ...
-
bioRxiv - Cell Biology 2023Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Immunology 2023Quote: ... Cells were stimulated with LPS (1 μg/ml) for 6 hours at 37°C followed by RNA isolation using a RNeasy Kit (QIAGEN). Extracted RNA was converted to cDNA with an iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... we used 6 mL of 55 °C Cell Lysis Solution from The Gentra Puregene® Cell and Tissue Kit (Qiagen) with 0.1 mg/mL proteinase K and 1% β-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Chromatin was treated with 1% SDS and 0.1 M NaHCO3 for 6 h at 65°C to reverse the cross-links and DNA was purified using columns (Qiagen) followed by ChIP-seq library preparation using ThruPLEX kit (Rubicon ...
-
bioRxiv - Immunology 2021Quote: ... genomic DNA was extracted from cells 3 d after electroporation using a QIAamp DNA Mini Kit or Micro Kit (QIAGEN) per the manufacturer’s protocols ...
-
bioRxiv - Genomics 2019Quote: ... True Methyl oxBS Module and genomic DNA according to manufacturers’ instructions (Qiagen, NuGen respectively). Bisulfite treated DNA served as templates to PCR-amplify three DNA fragments of 350-400 bp long that cover the entire MLH1 promoter region using ZymoTaq PreMix according to manufacturer’s instructions (Zymo Research) ...
-
bioRxiv - Microbiology 2020Quote: ... mouse β-actin (PPM02945B-200, Qiagen), or MHV-A59 N gene using RT2 SYBR Green qPCR Mastermix (330502 ...
-
bioRxiv - Pathology 2019Quote: ... DNA from D&C and endometrial biopsy specimens was extracted using the QIAamp® DNA FFPE Tissue Kit (QIAGEN, USA). All DNA was quantitated using the Qubit 2.0 Fluorometer (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μl of media from each of 6 plant wells or media from 3 minimal media wells were pooled and stabilized in RNAprotect® Bacteria Reagent (QIAGEN) before performing RNA extraction using RNeasy Mini Kit (QIAGEN) ...
-
bioRxiv - Genetics 2022Quote: ... and non-inoculated G305-3M leaf segments collected along 10 different time points (0, 3, 6, 9, 12, 16, 24, 36, 48, 72 hpi) using the RNeasy Plant Mini Kit (Qiagen, Germany). The cDNA was synthesized from total RNA using a qScript™ cDNA Synthesis Kit (Quantabio ...
-
bioRxiv - Biochemistry 2023Quote: ... for 45 min at 4°C and the supernatant was mixed with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Developmental Biology 2020Quote: ... All transfections were performed in D- or C-medium by using HiPerFect Transfection Reagent according to manufacturer’s instructions (301704, Qiagen, Hilden, Germany). After transfection for 24 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was then purified by mixing with beads at a 1:0.6 DNA/beads ratio followed by 3 washes with 70% ethanol and eluted with 30 μl of elution buffer (Qiagen Cat# 19086). Whole-exome sequencing was performed using the Mouse_Exome_Targets baitset from the Wellcome Sanger Institute pipeline ...
-
bioRxiv - Systems Biology 2022Quote: ... Ten millilitres of culture were pelleted by immediate centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... collected into an Eppendorf tube and centrifuged at 11200 rpm at 4 °C for 6 min followed by pellet resuspension with 200 μl of QIAzol (Qiagen, Hilden, Germany). To isolate EC from the bottom layer ...
-
bioRxiv - Molecular Biology 2020Quote: ... resuspended in Buffer RLT + β-mercaptoethanol (Qiagen), snap frozen on dry ice ...