Labshake search
Citations for Qiagen :
1 - 50 of 3244 citations for 6 chloro 3 hydroxymethyl 1 3 benzoxazol 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Neuroscience 2021Quote: ... We pooled 2-3 fishes (6 weeks old) and extracted whole RNA using the RNAEasy Micro kit (Qiagen), with blood ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Physiology 2022Quote: ... Fifteen milligrams of liver were homogenized in 200 µL of a 3:3:2 solution of acetonitrile:isopropanol:water (MeCN:IPA:H2O) in ceramic bead tubes (1.4 mm, Qiagen #13113-50) using a TissueLyzer II (Qiagen #85300) ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or a 3:2 mixture of QG buffer (QIAGEN) and isopropanol ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Immunology 2019Quote: ... Human RAC2 3’UTR was amplified with One Step Ahead RT-PCR kit (Qiagen) from human mRNA using the following primers RAC2 3’UTR+ ...
-
bioRxiv - Neuroscience 2022Quote: Tissue cultures that were cultivated on one filter membrane (3 cultures) were transferred as one sample into RLT buffer (QIAGEN) and RNA was isolated according to the manufacturer’s instructions (RNeasy Plus Micro Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Systems Biology 2023Quote: ... A culture volume equal to 3 mL of OD = 1 was added to 6 mL RNAprotect Bacteria Reagent (Qiagen), vortexed ...
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 mL of culture were mixed with 6 mL of RNAprotect bacteria reagent (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from patient material (n=3) and organoids (p1 and p2 n=3, p3 n=2) was extracted (RNeasy™ Mini Kit, Qiagen). To obtain cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... vIL-6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using QuantiTect Multiplex RT-PCR Kits (Qiagen) as described previously (37 ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Physiology 2023Quote: ... Ganglia in 1 mL of TRIzol reagent were homogenized using a TissueLyzer II bead mill (one 5 mm stainless steel bead per tube, 30 s-1 frequency for 3 minutes; Qiagen Inc. Hilden, Germany). The homogenates were incubated with 200 µL chloroform and centrifuged for 15 minutes at 12000 x g to isolate the protein-containing organic phase ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Microbiology 2022Quote: ... 3 mL samples were added to tubes containing 6 mL RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and vortexed ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... in a 2 mL centrifuge tube for 3 min using a TissueLyzer (Qiagen). The obtained mixture was serially diluted in 5.0 mL sterile phosphate buffer and 150 µL aliquots of 10−4 to 10−7 dilutions were spread onto plates containing a range of media ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitors 2 and 3) and then passing through Qiashredder columns (79656, Qiagen). Tissue samples were weighted ...
-
bioRxiv - Genomics 2024Quote: ... in a TissueLyser II apparatus (Qiagen Inc., USA; 2 × 3 min, 25 Hz). To remove phenol traces ...
-
bioRxiv - Microbiology 2024Quote: ... used for DNA extraction of minipig blood and (NM-3) one negative control for the kit DNeasy PowerWater (Qiagen) used for the DNA extraction of water samples ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Cell Biology 2019Quote: ... KIF4A siRNA 5’-CAGGTCCAGACTACTACTC-3’ against the 3’-UTR was obtained from QIAgen, and an optimised siRNA pool for KIF22 (KID ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3’mRNA-seq libraries were prepared using QIAseq UPX 3’ Transcriptome Kit (QIAGEN). In brief ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Plant Biology 2020Quote: Reduced His-tagged PRX-IIE (3 mg) or PRX-IIE C146S (3 mg) were bound to 1 mL Ni-NTA resin (Qiagen, Hilden, Germany) and used as affinity matrix ...
-
bioRxiv - Cell Biology 2019Quote: siRNAs used were as follows: Kif5b#3 (target sequence 5′-CAGCAAGAAGTAGACCGGATA-3′; Qiagen SI00176050), Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′ ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA from the original material used for next-generation sequencing of the serum and passage 3 cultured MRI103 virus was used as the template for amplification using the One-Step Ahead RT-PCR kit (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... and Chl523R (5’ CCY YMC GTA TTA CCG CAG CT 3’) targeting the 16S rRNA gene on a QIAcuity One digital PCR device (Qiagen) as recommended by the manufacturer ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Developmental Biology 2020Quote: RNA was extracted from 3 dpf and 6 dpf cdipt mutant zebrafish and their wildtype siblings using RNAeasy (Qiagen). RNA samples were reverse transcribed into cDNA using the iScript cDNA synthesis kit (BioRad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... An A base was added to the 3’ ends with Klenow (3’-4’ exo-) (Qiagen). The processed ds-cDNA was then ligated to Illumina sequencing adapters with T4 DNA Ligase (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... and organoids at the end of passage one subjected to two weeks of differentiation (n=3) using the RNeasy Mini Kit (Qiagen, 74104) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we homogenized 2-3 fecal pellets in 1 mL H2O using ceramic beads (NucleoSpin, Macherey–Nagel, Dueren, Germany) and a TissueLyser (Qiagen, Hilden, Germany), mixing the sample for 3 × 30 s at 4,500 rpm with a 10 s cooling break (< 0°C) ...
-
bioRxiv - Molecular Biology 2019Quote: ... A 1:3 mixture of a QuantiFast SYBR Green PCR Kit (Qiagen) and a FastStart SYBR Green Master (Roche ...