Labshake search
Citations for Qiagen :
301 - 350 of 3334 citations for 6 Quinolinamine 1 ethyl 1 2 3 4 tetrahydro 2 2 4 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... using a TissueLyzer II (QIAGEN, 2min, 25 Hz, 2 times). The samples were incubated at room temperature for 5min ...
-
bioRxiv - Immunology 2023Quote: ... following a 2-step VDJ amplification using HotStarTaq Plus (Qiagen). PCR products were enzymatically cleaned again and illumina adapters and indexes were introduced via PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a 48-sample holder (Tissue Lyser 2, Qiagen). The samples were treated with 1 ml pre-cooled (-20°C ...
-
bioRxiv - Microbiology 2023Quote: ... fitted with a 2 ml tube holder (Qiagen, Germantown, MD). RNA was purified with the ZymoBIOMICS RNA Miniprep kit (R2001 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Pellets were thawed in 2 mL RLT lysis buffer (Qiagen) containing 10 μL mL-1 of 2-mercaptoethanol ...
-
bioRxiv - Physiology 2024Quote: ... The supernatant was incubated with 2 mL Ni-NTA (Qiagen) for 1 hour at 4°C with gentle mixing ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNA was extracted from 1-to 2-mm-long tail tips using the DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). Genomic DNA (5 μl ...
-
bioRxiv - Cell Biology 2020Quote: ... The qPCR was performed using the TaqMan™ RNA-to-CT™ 1-Step kit (Thermo Fischer Scientific) and was run in a RotorGene-6000-2-plex (Qiagen). PCR conditions having reverse transcription at 48’C for 15 min ...
-
bioRxiv - Immunology 2022Quote: ... of soluble SARS-CoV-2 WA1 and SARS-CoV-2 Omicron BA.1 spike trimers were isolated from cell supernatants using a Ni-NTA column (Qiagen, Hilden, Germany). Eluents from Ni-NTA purifications were subjected to SEC using a HiLoad Superdex 200 16/600 column followed by a Superose 6 10/300 (Cytiva ...
-
bioRxiv - Microbiology 2023Quote: ... we placed filters in 2 mL tubes with beads and 1 mL TE buffer (Qiagen plasmid isolation kit, Qiagen Germantown, MD, USA) and ran them in the tissue lyser at either ½ speed or max speed for 30 sec or 1 min ...
-
bioRxiv - Genomics 2019Quote: ... cfDNA was extracted from 1 or 4 ml of urine according to manufacturer recommendations (Qiagen Circulating Nucleic Acid Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 °C) and the supernatant was then loaded onto 1 ml HisTrap HP column (Qiagen) at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... the supernatant was incubated for 1 hour at 4°C with Ni-NTA-agarose (Qiagen), washed several times with lysis buffer and the protein was eluted by incubation for 3 hours with lysis buffer containing 500 mM imidazol ...
-
bioRxiv - Genomics 2023Quote: ... Button valves were opened and biotinylated anti-pentaHis antibody (Qiagen, 1:4 dilution in HEPES) was flowed for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... RNA from each Xenopus embryo (n=2-3/condition) was separately extracted and purified using the RNeasy Micro Kit (Qiagen; Venlo, Netherlands) and microarray measurements were performed using the GeneChip Xenopus laevis Genome 2.0 Array (Affymetrix ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Tissue was ground to a fine powder at −80°C using 3-mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA). Ground samples were extracted with 1 mL of cold methanol containing [phenyl 13C6]-IAA (0.1 nmol/mL ...
-
bioRxiv - Plant Biology 2023Quote: ... Collected tissue was ground to a fine powder at -80°C using 3 mm stainless steel beads at 50 Hz for 2*30 seconds in a TissueLyser LT (Qiagen, Germantown, USA), and between 10-15 mg of ground tissue per sample was used for auxin extraction ...
-
bioRxiv - Systems Biology 2019Quote: ... Approximately ∼50 mg frozen tissue was pulverised in methanol-chloroform (300 µl, 2:1 v/v) using a TissueLyser (Qiagen, West Sussex, UK). Then the mixture was sonicated for 10 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA from untreated or RSL3-treated (with or without 2 hr pre-treatment with 2 µM Ferrostatin-1) MM1S and MM1R cells was extracted using the RNeasy Mini Kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2023Quote: ... A culture volume equal to 3 mL of OD = 1 was added to 6 mL RNAprotect Bacteria Reagent (Qiagen), vortexed ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from 4-6 dpf zebrafish larvae using the RNeasy Plus Micro Kit (Qiagen). cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Bioengineering 2020Quote: ... Each well is then diluted with 1 to 4 v:v in RNAse free elution buffer (QIAgen) to a total volume of 8 µL ...
-
bioRxiv - Genetics 2019Quote: ... cfDNA was extracted from 2 mL of plasma at baseline and from 3 mL of plasma post-treatment using QIAamp DNA purification kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from peripheral blood leukocyte samples from visit 2 or 3 using the Gentra Puregene Blood Kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions (www.qiagen.com ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... placed into a 2 mL tube with 600 μL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989), then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...