Labshake search
Citations for Qiagen :
401 - 450 of 2165 citations for 6 Oxo 5 6 7 8 tetrahydronaphthalene 2 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 7-day-old roots using the RNeasy Plant Mini Kit (Qiagen) and QIAcube (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 30 mg of frozen tissue was placed into a 2 ml flat bottom centrifuge tube on dry ice with a 5 mm stainless steel bead (QIAGEN Germantown, MD, USA; Cat#69989) at the bottom ...
-
bioRxiv - Microbiology 2021Quote: ... 5-plex (Qiagen, Germany), the QIAcuity One-Step Viral RT-PCR Kit (Cat No ...
-
bioRxiv - Cell Biology 2020Quote: ... + 5 μM TSO (Qiagen). Amplification of cDNA (22 amplification cycles ...
-
bioRxiv - Cell Biology 2021Quote: ... 5×10^5 EpCAM+ve cells were lysed in 350μL RTL Buffer (Qiagen) containing 143mM β-Mercaptoethanol (aided by cell searing via passage ...
-
bioRxiv - Cell Biology 2020Quote: Adrenal glands were homogenized in ammonium-bicarbonate buffer (150 mM ammonium bicarbonate, pH 7) with TissueLyser (Qiagen). Protein content was assessed using BCA Protein Assay Kit (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2021Quote: DNA was extracted from 0.5-7 mg biomass using DNeasy Powersoil microbial extraction kit (Qiagen, Hilden, Germany) accordingly to manufacturer’s instructions and stored at -20°C ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA was isolated from roots of 7-day-old seedlings using RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and 7 were isolated using a Plant RNeasy Mini kit with DNase I treatment (Qiagen, Hilden, Germany). Three biological replicates were prepared for each tissue type ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA from the MC.7.G5 clone was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and from blood by using either DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Plant Biology 2019Quote: ... Sequence files were processed in CLC Genomics Workbench version 8 (Qiagen Bioinformatics, Hilden, Germany); paired Illumina read files and 454 sequencing files were indicated during import ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was isolated from >8 bacterial colonies using QIAprep® Spin Miniprep Kit (Qiagen) and TRIM1 knockout confirmed by sequencing using a T3 forward promoter to confirm truncating stop codons in all copies of the TRIM1 gene present in the genome of selected clones ...
-
bioRxiv - Microbiology 2020Quote: ... Sequences were aligned to the reference viral genome using CLC Sequence Viewer 8 (Qiagen).
-
bioRxiv - Microbiology 2023Quote: RNA was extract from 8 x 106 cells using the RNeasy Mini Kit (Qiagen) protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4C (Qiagen, SI05163977), and 20 nM HIF1A Flexitube GeneSolution siRNA (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4B (Qiagen, SI00449764), 5 nM siKDM4C (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Genetics 2021Quote: ... 5 mM Multiplex-Kit (Qiagen) and HPLC water to a total volume of 10 μL per sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 uL EB buffer (QIAGEN) was added to each well and mixed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 μl RLT (79216, Qiagen) was added ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from the gut samples (7-10 guts/sample) using the RNeasy Mini kit (Qiagen) and the on-column DNase I treatment (79254 ...
-
bioRxiv - Biochemistry 2021Quote: ... supernatant was harvested after 7 days of expression and incubated with 300 μL of Ni-NTA resin (Qiagen) at 4°C overnight ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was extracted from seedlings 7 dpg using the RNeasy Plant RNA Extraction kit (Qiagen Ltd., Surrey, UK). RT-PCR was performed using the OneStep RT-PCR kit (Qiagen ...
-
bioRxiv - Bioengineering 2022Quote: Tissue samples at day 0 and 7 were collected from devices and dissociated in the lysis buffer (Qiagen) by agitating with an electronic pestle for 1 min ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from MCF-7 cells (1×106 cells/well) was isolated using RNeasy Mini kit (74106; Qiagen), and 500ng cDNA was synthesized with random hexamers by reverse transcription (SuperScript III ...
-
bioRxiv - Pathology 2020Quote: ... diffracting crystals of P1_102-157 were obtained at 4°C from condition 7 of the Classic kit (Qiagen) containing 0.1 M tri-Sodium citrate pH 5,6 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 120 µL of elution buffer of elution buffer II (10 mM Tris pH 8.0, 1 mM EDTA, 0.67% SDS) and 7 µL Proteinase K (Qiagen) was added ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... Transfection into C2C12 or MCF-7 cells utilized a lipid-based reagent (Fast-forward protocol, Effectene reagent, Qiagen). As a reference for transfection efficiency ...
-
bioRxiv - Plant Biology 2023Quote: ... The grinding was done using 7 mm stainless steel beads with TissueLyser II bead mill (Qiagen, Hilden, Germany), 2 minutes totally at 25 Hz ...
-
bioRxiv - Immunology 2023Quote: ... cytometry-sorted 7-AAD- CD45+CD11b+F4/80+ cells were lysed in 350µL RLT lysis buffer (Qiagen, 79216). At 4 days post injury ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNAs were extracted from 8×105 cultured cells using RNA isolation kit (Qiagen, Germany) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2019Quote: ... eight milliliters of culture was added to 8 ml of RNA Protect bacteria reagent (Qiagen) in 50-ml sterile tubes and then vortexed immediately for 5 sec and incubated at room temperature for 5 min ...
-
bioRxiv - Genetics 2019Quote: ... Promoter sequences were assembled and aligned with CLC Main Workbench 8 software (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2021Quote: ... Sanger sequencing results were trimmed and assembled using CLC Main Workbench 8 (Qiagen, Hilden, Germany) using the default settings ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysate was passed over a gravity column of 8 mL of Ni-NTA resin (Qiagen), washed with 70 mL wash buffer (20 mM HEPES-KOH pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted from 8 whole larvae using the QIAGEN RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 10 mM imidazole) and was added to 8 mL Ni-NTA resin (Qiagen, Hilden, Germany) preequilibrated with lysis buffer and rocked for 1 hour at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA from h-iECs which have been expanded for 7 days was extracted using Rneasy Mini Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... and their bat orthologues [(Pteropus alecto (XP_006907484.1) and Desmodus rotundus (XP_024413747.1)] were subjected to multiple alignment using CLC workbench 7 (CLC Bio, Qiagen, Aarhus, Denmark).
-
bioRxiv - Microbiology 2021Quote: RNA was extracted from ME49 Δhxgprt::Fluc tachyzoites and bradyzoites induced for 7 days at pH 8.2 using RNeasy Mini Kit (Qiagen) combined with QIAshredder (Qiagen ...
-
bioRxiv - Genomics 2021Quote: ... A neighbour-joining tree was built using the Jukes-Cantor nucleotide distance model and 1,000 bootstraps in CLC Sequence Viewer 7 (Qiagen).
-
bioRxiv - Microbiology 2020Quote: DNA for metagenomic sequencing was extracted from ~7 g sediment (~0.7 g sediment in 10 individual lysis tubes) using PowerSoil DNA Isolation Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... the samples were run in the ViiA 7 Real-Time PCR System with the QuantiTect SYBR Green (Qiagen, 204143) (2017) ...
-
bioRxiv - Genomics 2023Quote: Genomic DNA was harvested from post-transfection HuH-7 cells using the DNeasy Blood & Tissue Kit (Qiagen, catalog #69506). Similarly ...
-
bioRxiv - Immunology 2023Quote: M1 and M2 macrophages (300,000/well, 96-well plate) were transfected on Day 7 with MALAT1 or control GapmeRs (Qiagen). MALAT1- or control GapmeR-transfected M1 and M2 Mφ were incubated with Texas Red-conjugated Ova and DQ-conjugated Ova (both 1 mg/ml ...
-
bioRxiv - Immunology 2023Quote: ... GC B cells (Live/Dead-CD19+IgD-CD95+GL-7+) and naïve B cells (Live/Dead-CD19+IgD+) were flow sorted into RLT Plus buffer (Qiagen) following pre-enrichment with the Pan B Cell Isolation Kit II (Miltenyi) ...