Labshake search
Citations for Qiagen :
201 - 250 of 2287 citations for 6 Octen 1 ol 3 7 dimethyl 1 formate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Ni-NTA agarose beads (1 ml; Qiagen), washed and resuspended in loading buffer (50 mM Tris ...
-
bioRxiv - Immunology 2021Quote: ... 1-unit HotStarTaq Plus (QIAGEN, Cat#: 203607), 190 nM 3’ primer pool ...
-
bioRxiv - Cell Biology 2021Quote: Myosin-18A siRNA – #1 CACGAACTGGAGATGGATCTA (Qiagen SI04273668), #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cell Biology 2021Quote: ... 25 nM of S1PR1 #1 (Qiagen, #SI00376201) 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... stored in 1 ml RNAlater (Qiagen, Netherlands), and moved to a −20 °C freezer for up to a month until RNA was extracted ...
-
bioRxiv - Genetics 2019Quote: ... 1 μL of Q-Solution from Qiagen® and H2O ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μM barcode LNA RT primer (Qiagen), 1U/μL RiboLock RNase inhibitor (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 uL ∼1.07 AU/mL Protease (Qiagen) was added to each well and incubated at 37 °C for 40 min ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μL GlycoBlue coprecipitant (Qiagen; AM9515). RNA was precipitated after holding overnight at -80°C and centrifugation ...
-
bioRxiv - Biochemistry 2023Quote: ... anti-RGS-His (Qiagen, 1:2000, 34610), anti-Myc (ChromoTek ...
-
bioRxiv - Biochemistry 2022Quote: ... Mouse anti-His (Qiagen, 34670; 1:200) and goat anti-mouse IgG-AF488 (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 μl Type-it Master Mix (Qiagen), 0.17 μM of either FAM or VIC ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... containing 1 × Master Mix (Qiagen Multiplex Kit), 0.4 μg/μL of BSA ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mL RNAProtect Bacterial Reagent (Qiagen, #76506) was added to each sample and thawed on wet ice for 10 min ...
-
bioRxiv - Genetics 2023Quote: ... 1 ul of 25 mM MgCl2 (Qiagen) and 1 ul of the primer mix (40 uM of the Forward primer ...
-
bioRxiv - Cell Biology 2021Quote: ... si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’, Qiagen), si-uS19 (5’-UCACCUACAAGCCCGUAAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-eS4X (5’-CUGGAGGUGCUAACCUAGGAA-3’, Qiagen), si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted from 7 days old protonema using DNeasy Plant Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Total RNA was isolated from 7 days old protonemata with RNeasy Plant Mini Kit (Qiagen), treated with DNaseI (DNA-free™ DNA Removal Kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA isolation from 7 PDXs was performed with the Qiagen RNA Kit (Qiagen, Hilden, Germany). Sample quality was assessed using Agilent RNA 6000 Nano Reagent on Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... and collected into a PCR tube containing 7 µL of 2×TCL lysis buffer (Qiagen) with 2% v/v 2-mercaptoethanol (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... The 488 SRAs were assembled using skesa (74) or the CLC Genomics Workbench 7 (QIAGEN) using default parameters ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was isolated from 7-days-old protonemata with RNeasy Plant Mini Kit (Qiagen), treated with DNaseI (DNA-free™ DNA Removal Kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... reads from the two fastq files were paired using CLC Genomics Workbench 7 (Qiagen, Germany). Paired and unpaired data were uploaded and analysed on the public server at usegalaxy.org (48) ...
-
bioRxiv - Genomics 2022Quote: ... 400 nL of protease mix (6 μg protease (Qiagen, 19155), 6.25x NEBuffer 4 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 6 and 9 employing the RNeasy plant mini kit (Qiagen). RNA was quantified using Nanodrop (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... For MUS81 interference it was used FlexiTube HsMUS81 6 (Qiagen). SMARCAL1 was depleted using the MISSION esiRNA HUMAN SMARCAL1 (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2023Quote: ... 6 million PBMCs were lysed using QIAzol Lysis Reagent (Qiagen). Samples were stored at -80°C until RNA extraction ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 µg C19orf43 (purified from E. coli BL21 through Qiagen Ni-TA agarose using standard procedures ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 mL of Ni2+-NTA slurry (Qiagen, Venlo, LI, Netherlands) were equilibrated in a gravity flow column with Wash Buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... UniSpike 6 (included in the QIAGEN miRCURY LNA RT Kit) to verify the efficacy of reverse transcription (RT ...
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid expressing VSV-G or HIVKB9 envelope glycoproteins were cotransfected at the mass ratio of 9:1 (9 Hi.fate / 1 Env) using Effectene (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... or WT-Cav-1 (1 µg) plus EphB1-Y600F-YFP (2.5 µg using Superfect transfection reagent (cat #301305, Qiagen). Media was replaced 6 h after transfection with fresh DMEM media containing 10% FBS ...
-
bioRxiv - Microbiology 2022Quote: ... 1 mL of the 2-mL culture was removed and replaced by 1 mL of RNAprotect Cell Reagent (Qiagen). After 5 min of incubation ...
-
bioRxiv - Microbiology 2022Quote: ... 200 RPM for 2 h then approximately 1×109 CFU of bacteria were mixed at a 2:1 (vol:vol) ratio of RNAProtect (Qiagen) and incubated at room temperature for 5 min ...
-
bioRxiv - Physiology 2020Quote: ... insulin-like growth factor 1 receptor (Igf1r) and sirtuin 1 (Sirt1) gene promoters were designed using the Pyromark Assay Deisgn 2.0 software (Qiagen). PCR and sequencing primers are provided in Supplementary Table 1 ...
-
bioRxiv - Plant Biology 2022Quote: RNA was extracted from 10-day-old whole seedlings grown on 1/2X MS media containing 1% sucrose and 0.8% agar (Plant RNeasy kit (Qiagen)) ...
-
bioRxiv - Microbiology 2023Quote: TG was quantified in snap-frozen liver tissue stored at −80 □C until cryo-grinding in liquid nitrogen and 50 ±5 mg tissue added 0.9 mL of a 2:1 chloroform:methanol solution and homogenized 1 min at 50 os/sec using a TissueLyser LT (Qiagen) with beads ...
-
bioRxiv - Systems Biology 2023Quote: ... x mg solid matrix were mixed with five times the μl amount of ACN:water (1:1, v/v) and homogenised with a TissueLyser II (30 Hz, 10 min; Retsch Qiagen). After a short centrifugation (2 min ...
-
bioRxiv - Physiology 2022Quote: ... Fifteen milligrams of liver were homogenized in 200 µL of a 3:3:2 solution of acetonitrile:isopropanol:water (MeCN:IPA:H2O) in ceramic bead tubes (1.4 mm, Qiagen #13113-50) using a TissueLyzer II (Qiagen #85300) ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from 7 day-old seedlings with the RNeasy Plant Mini Kit (Qiagen). 300 mg of total RNA were reverse transcribed with ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted from 7-day-old seedlings using RNeasy® Plant Mini-Kit (QIAGEN) and treated with RNase-Free DNase (QIAGEN) ...
-
bioRxiv - Cell Biology 2022Quote: COS-7 cells were transfected with the respective Myc-Sun4-pEGFP fusion constructs using EffecteneTM (Qiagen) following the manufacturer’s protocol and incubated overnight before analysis of the ectopically expressed fusion proteins.
-
bioRxiv - Immunology 2020Quote: ... skin was homogenized in TRIzol using two 7 mm metal beads and a TissueLyser LT (Qiagen). Homogenates were centrifuged to separate an RNA containing aqueous phase ...
-
bioRxiv - Genetics 2020Quote: DNA from 7-day old leaves was extracted for all genotypes using the QIAamp kit (Qiagen) on the QIAcube HT (Qiagen ...
-
bioRxiv - Genetics 2019Quote: ... DNA from ~7×106 cells was extracted using a Blood & Cell Culture DNA Midi Kit (QIAGEN) and amplified to examine the coverage of mutant cell libraries ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 7-day-old roots using the RNeasy Plant Mini Kit (Qiagen) and QIAcube (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 1 μl 1:10 diluted oligonucleotides (for RNA from immunopurified ribosomes) from the QIAseq FastSelect –rRNA Yeast Kit (Qiagen) in 10.5 μl total at 75°C ...
-
bioRxiv - Immunology 2021Quote: ... DNA was extracted from circulating PD-1+ and PD-1− CD8+ T cells using the All-Prep DNA/RNA Micro Kit from Qiagen and sent to Adaptive Biotechnologies for survey-level TCRβ sequencing.