Labshake search
Citations for Qiagen :
401 - 450 of 3391 citations for 6 O TOLYL IMIDAZO 2 1 B THIAZOLE 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: RNA was isolated from MACS-sorted splenic B cells with the RNA Mini Kit (Qiagen, Hilden, Germany). Quantification of RNA was performed with a NanoPhotometer (Implen ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from enriched B cells using the RNeasy Micro Kit (Qiagen, cat no. 74004) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from B-cells or mice tissue using RNA isolation kit (Qiagen, Valencia, CA) and then converted to complementary DNA using TaqMan Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... total RNA was extracted from the B cells using the RNeasy Mini Kit (Cat. #74004, QIAGEN, Germany) as per the manufacturer’s instruction ...
-
bioRxiv - Immunology 2024Quote: Splenic B cells were stimulated as indicated and RNA was isolated using RNeasy Plus Mini Kit (Qiagen). RT-PCR was carried out as described8 using the following primers ...
-
bioRxiv - Biophysics 2021Quote: ... Supernatant was collected for 2.5 h binding with Ni-nitrilotriacetic acid resins (Qiagen) at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... His6-AHCY was isolated by Ni2+-nitrilotriacetic acid (Ni-NTA) affinity chromatography (Qiagen) using standard procedures and eluted with 50 mM Tris buffer pH 8.0 ...
-
bioRxiv - Genomics 2019Quote: ... cfDNA was extracted from plasma using the QIAamp Circulating Nucleic Acid Kit (Qiagen) following the manufacturer’s protocol with minor modifications ...
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was mixed with nickel-nitrilotriacetic acid agarose beads (Qiagen, Hilden, Germany) and loaded on a column ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... cfDNA was extracted from plasma using the QIAamp circulating nucleic acid kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The remaining lysates were incubated with nickel-nitriloacetic acid (Ni-NTA) beads (Qiagen) for 1.5 h at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was mixed with nickel-nitrilotriacetic acid agarose beads (Qiagen, Hilden, Germany) and loaded on a column ...
-
bioRxiv - Plant Biology 2020Quote: ... Recombinant proteins were affinity purified using nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) and elution with imidazole ...
-
bioRxiv - Genomics 2021Quote: ... Nucleic acids were extracted using a QIAGEN DNeasy (DNA) kit (Qiagen Hilden, Germany). Three de novo genome sequencing methods were performed on the liver fluke ...
-
bioRxiv - Microbiology 2022Quote: Nucleic acids were extracted from samples using a DNeasy PowerSoil kit (Qiagen, Germany) and quantified using the Quant-IT PicoGreen assay kit (Invitrogen ...
-
bioRxiv - Physiology 2020Quote: ... DNA from plasma was extracted with the QIAamp Circulating Nucleic Acid Kit (Qiagen).
-
bioRxiv - Biochemistry 2019Quote: ... The protein was isolated by Ni2+-nitrilotriacetic acid (Ni-NTA) affinity chromatography (Qiagen). Proteins were eluted with 50 mM Tris buffer pH 7.5 ...
-
bioRxiv - Genomics 2021Quote: ... Amino acid sequences were aligned using CLC Genomics Workbench 20.0.04 (QIAGEN, Aarhus, Denmark).
-
bioRxiv - Genomics 2021Quote: Nucleic acids were extracted by homogenizing tissues using a TissueLyser II (Qiagen, 85300) followed by the AllPrep DNA/RNA/miRNA Universal Kit (Qiagen ...
-
Epigenetic alterations underlie airway macrophage differentiation and phenotype during lung fibrosisbioRxiv - Immunology 2020Quote: Nucleic acids were extracted from cells using the AllPrep Mini Kit (QIAGEN, Germany). DNA quality and quantity were assessed using Genomic DNA ScreenTape and TapeStation System (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... Chondrocytes were transfected in duplo with antisense locked nucleic acid (LNA) GapmeR (Qiagen) targeting P3H2-AS1 (TGAGCAACTAGGTGTA ...
-
bioRxiv - Cell Biology 2021Quote: ... The soluble recombinant protein was purified using theNickel-Nitrilotriacetic acid (Ni-NTA+; Qiagen) resin ...
-
bioRxiv - Cancer Biology 2023Quote: ... all proteins were purified using Ni-NTA (nickel-nitrilotriacetic acid) resin from QIAGEN. After the incubation of Expi293 media supernatant with the Ni-NTA resin ...
-
bioRxiv - Cell Biology 2023Quote: ... The proteins were first purified using nickel-nitrilotriacetic acid (NTA) agarose resin (Qiagen), and the His8-SUMO tag was then removed by TEV protease (10:1 w/w ...
-
bioRxiv - Microbiology 2023Quote: ... viral nucleic acids were extracted using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with Ni-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germany) on a rocker for 1 hour at 4° C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... after which the chemokine was purified using nickel-nitrilotriacetic acid (NTA) resin (Qiagen). Purified CCL5 was refolded by first adding 4mM DTT to the eluate at pH>7 ...
-
bioRxiv - Microbiology 2023Quote: ... Bacterial nucleic acid was extracted using the EZ1 DNA tissue kit (Qiagen, Germany) on EZ1 Advanced XL (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: Locked nucleic acid (LNA) GapmeR ASOs were custom-designed and purchased from Qiagen, USA ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time PCR assays were carried out in triplicate to amplify the Wolbachia wsp gene [43] and host reference gene GAPDH (378 F_ 5’-CCGGTGGAGGCAGGAATGATGT-3’, 445 R_5’-CCACCCAAAAGACCGTTGACG-3’) on a Rotor-gene Q Instrument (Qiagen, NSW, Australia). Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
SARS-CoV-2 comprehensive receptor profiling: mechanistic insight to drive new therapeutic strategiesbioRxiv - Cell Biology 2021Quote: ... each pre-incubated at a 2:1 molar ratio with Penta His Alexa Fluor 647 Conjugate (Qiagen, UK). Hits (duplicate AF647 positive spots ...
-
bioRxiv - Plant Biology 2020Quote: ... The clear supernatant was then gently mixed with 1 ml of Ni+2-NTA agarose beads (Qiagen, Germany) for 30 min and then added to the column with a flow rate of 0.5 ml/min ...
-
bioRxiv - Immunology 2022Quote: ... diluted in Milli-Q H2O 1:2 and the cells disrupted by mechanical lysis in the TissueLyser (Qiagen) for 2 minutes at 30 Hz and three freeze/thaw cycles (20° to -20°C).
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5μl of diluted cDNA (1:3 - nuclease-free water) was used as template in 10μl real-time PCR reactions (Qiagen: ‘SYBR Green PCR kit’) to assay specific transcripts (BioRad ...
-
bioRxiv - Physiology 2023Quote: ... Ganglia in 1 mL of TRIzol reagent were homogenized using a TissueLyzer II bead mill (one 5 mm stainless steel bead per tube, 30 s-1 frequency for 3 minutes; Qiagen Inc. Hilden, Germany). The homogenates were incubated with 200 µL chloroform and centrifuged for 15 minutes at 12000 x g to isolate the protein-containing organic phase ...
-
bioRxiv - Systems Biology 2019Quote: ... B cells from an individual experiment were pooled and used to isolate RNA with RNeasy Mini kit (QIAGEN). After treatment with Ambion Turbo DNase ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was isolated from B cells either using Blood and Tissue or Flexigene kits (Qiagen, Hilden, Germany). DNA was quantified with Qubit (ThermoFisher ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted from naïve and cultured B cells using Trizol and RNeasy kit and Dnase treatment (Qiagen) and retro-transcribed to cDNA using random hexamers (Roche ...
-
bioRxiv - Immunology 2020Quote: DAFhi and DAFlo GC B cells (CD19+ CD20+ CD38+ IgD−) were resuspended in RLT cell lysis buffer (Qiagen) after flow cytometric sorting ...
-
bioRxiv - Genetics 2019Quote: DNA was extracted from blood or cell lines using the Puregene Blood Core Kit B (Qiagen, Cat#158467). PCYT1A exons were PCR-amplified from SMD-CRD patient genomic DNA with Accuprime Taq polymerase (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: Total RNA was extracted from FO and MZ B cells using the RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... ∼12,000-15,000 B cells from the tetramer-enriched fraction were sorted directly into Buffer RLT (Qiagen; Hilden, DE) prior to shipment on dry ice to iRepertoire ...
-
bioRxiv - Molecular Biology 2023Quote: Inhibitors (antimiRs) against miR26b-5p and miR200a/b/c-3p were purchased from Qiagen (339130 and 339160 respectively). AntimiRs in injection media (1mM Tris-HCL pH 7.5 and 0.5 mM EDTA in embryo grade water ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested 6 h post-transfection and the extracted RNA (RNeasy, Qiagen) reverse transcribed to produce cDNA (QuantiTect ...
-
bioRxiv - Cell Biology 2020Quote: ... in the wells of 6 well plates (35mm) using Effectene transfection reagent(Qiagen) according to the manufacturer instructions ...