Labshake search
Citations for Qiagen :
401 - 450 of 2026 citations for 6 N CARBETHOXY 3 CHLORO 7 8 DIHYDRO 5H PYRIDO 4 3 C PYRIDAZINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Genetics 2021Quote: Genomic DNA was extracted from an aliquot of 3 × 106 cells using the Gentra Purgene Kit (Qiagen). The genomic region surrounding the CRISPR/Cas9 target site (741 bp ...
-
bioRxiv - Microbiology 2020Quote: ... and 6.25mL 2-mercaptoethanol (βME)) and homogenized at 30Hz for 3 min in a TissueLyzer II (Qiagen). 60 μL of 100% isopropanol was added to each tube and incubated for 1 min ...
-
bioRxiv - Bioengineering 2022Quote: ... messenger RNA (mRNA) combined from at least 3 gels were isolated with an RNeasy Mini Kit (Qiagen) and then reverse transcribed into complementary DNA (cDNA ...
-
bioRxiv - Immunology 2022Quote: ... DNA was extracted from frozen cell pellets (3×107 cells; Blood & Cell Culture DNA Maxi Kit, Qiagen) per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA (>200nt) was extracted from 400 testes of ≤3 days old flies using miRNeasy Mini column (QIAGEN). For the first replicate ...
-
bioRxiv - Cancer Biology 2023Quote: Small interfering RNA was obtained to knockdown the expression of ARSB and galectin-3 (Qiagen, Germantown, MD). Effects on mRNA were determined by QRT-PCR ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from pools of 2-3 organoids using RNeasy Plus Mini Kit (Qiagen, #74134) according to the manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant from the second spin was incubated with 3 mL of Ni-NTA agarose beads (Qiagen) for 30 minutes at 4°C in the cold room ...
-
bioRxiv - Microbiology 2024Quote: ... MRU2687-3 and ZH548 viral stocks were extracted using the QIAmp Viral RNA kit (Qiagen; Courtaboeuf, France) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and AR DBD domain DNA fragment were cut by NheI (N-terminal) and XhoI (C-terminal) and purified with the QIAquick Gel Extraction Kit (Qiagen; cat. 28704). After ligation with T4 DNA Ligase (New England ...
-
bioRxiv - Microbiology 2021Quote: ... 6 (Qiagen) for additional analysis ...
-
bioRxiv - Cancer Biology 2020Quote: ... then spun at 14000K RPM for 10 minutes at 4°C to pellet debris (Qiagen, 37901). Protein concentration in the supernatant was quantified using BCA assay (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) and supernatant was transferred to tubes containing 30µl precleared Ni-NTA agarose beads (Qiagen) in the presence of 0.05% Tween-20 and 15mM imidazole ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... rotated at 4°C for 1.5-2 hr in 0.75 mL equilibrated Ni-NTA Agarose (Qiagen), followed by packing pre-equilibrated Poly-Prep Chromatography Columns (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plugs were allowed to solidify at 4°C and were then incubated with Proteinase K (QIAGEN) (1 h at 50°C and then overnight at 37°C) ...
-
bioRxiv - Immunology 2023Quote: ... Cells were stimulated with LPS (1 μg/ml) for 6 hours at 37°C followed by RNA isolation using a RNeasy Kit (QIAGEN). Extracted RNA was converted to cDNA with an iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... we used 6 mL of 55 °C Cell Lysis Solution from The Gentra Puregene® Cell and Tissue Kit (Qiagen) with 0.1 mg/mL proteinase K and 1% β-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Chromatin was treated with 1% SDS and 0.1 M NaHCO3 for 6 h at 65°C to reverse the cross-links and DNA was purified using columns (Qiagen) followed by ChIP-seq library preparation using ThruPLEX kit (Rubicon ...
-
bioRxiv - Evolutionary Biology 2019Quote: DNA from parental and all second-generation hybrid offspring (KonPar: N = 263; PruKoh: N = 193; CerEuk: N = 230) was isolated using the DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA) and sequenced following the Genotype-By-Sequencing (GBS ...
-
bioRxiv - Neuroscience 2022Quote: At DIV 28-30 iPSC-MG from 8 C9orf72 ALS/FTD patient lines and 4 control lines were pelleted and lysed using QIAshredder (QIAGEN-79654) and RNA was isolated with RNeasy Mini Kit (QIAGEN-74104 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and damaged OA cartilage with a Mankin score of 4 or higher (n=1, female, 80 years old) using MiRNeasy Kit (Qiagen, Germantown, USA). RNA was quantified using the Nanodrop 1000 Spectrophotometer (Thermo Fisher ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA from magnetically purified human NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 4) hiPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated from 3 months old Pgrcre and FOXL2OE diestrus uteri using RNeasy mini kit (Qiagen). The library was prepared using TruSeq RNA Library Prep kit (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... beat-beading tubes were filled 1/3 with beads and soaked overnight in 500 μl buffer RLT (Qiagen). Tubes were spun at full speed and excess buffer removed ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from 3-day-old seedlings using a QIAshredder and RNeasy Plus Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 1000 µL PBS was added to each sample (lungs, 0.01–0.04 g) along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized at a speed of 10 Hz for 10 min and then centrifuged at 15,000 × g for 10 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples were then ground to powder using a 3 mm tungsten carbide bead (Qiagen Cat. No. / ID: 69997) on a TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... homogenized in sterile 0.05 % NP40 in H2O for 3 minutes at 25 Hz using a Tissue Lyzer (Qiagen) and serial dilutions were plated on YPD agar containing 100 μg/ml Ampicillin ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were transfected at 3 DIV with siRNA targeting Kdm6a or ntRNA using Effectene Transfection Reagent (Qiagen, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 500 µl of PBS-AB was added to each sample along with Tungsten carbide 3 mm beads (Qiagen). Samples were homogenized during 10 min and then centrifuged at 15,000 g for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then washed 3 times with PBS and lifted with 500µL/well of Cell Protect Reagent (Qiagen) for 5 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Genomics 2020Quote: Total RNA of 2-3 million cells was isolated using miRNeasy Kit according to the manufacturer’s instructions (Qiagen). The quality of the RNA was assessed by a standard sensitivity NGS fragment analysis kit on Fragment Analyzer (Advanced Analytical Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... benthamiana leaves were grinded in a tube with two glass beads (3 mm) with a TissueLyser II (Qiagen) and directly after supplied with 600 μl EB ...
-
bioRxiv - Microbiology 2019Quote: ... RNA samples from 3 independent cultures for each strain (Chr_dam and Chr_gfp) were extracted with RNeasy miniprep kit (Qiagen). Primers used are listed in Table S1 ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from an aliquot of 3 x 106 cells using the RNeasy Plus Kit (Qiagen). cDNA was synthesized from extracted RNA using the iScript cDNA Synthesis Kit (BioRad ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA was extracted from 2-3 embryos pooled per genotype using the RNeasy Mini Kit (QIAGEN, 74106) and QIAshredder columns (QIAGEN ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Molecular Biology 2022Quote: ... genomic DNA was isolated from HEK293T cells 3 days after transfections using the Gentra Puregene Cell Kit (Qiagen) and was diluted to 10 ng/μL ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed 3 times with PBS and had their genomic DNA extracted with the QIAamp DNA mini kit (QIAGEN). Sequencing libraries were prepared at GenomeScan (Netherlands ...
-
bioRxiv - Immunology 2023Quote: ... total RNA from 2 or 3 million peripheral blood mononuclear cells (PBMCs) was extracted (RNeasy Maxi Kit, Qiagen) from each time point (2015 (112 months p.i) ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated from 0 or 3% CSE-treated bronchospheres using the Qiagen RNeasy Mini Kit (Qiagen 74106). The RNA yield was measured using Agilent TapeStation (4200 TapeStation System ...
-
bioRxiv - Microbiology 2023Quote: ... Individual mosquitoes were homogenized for 3 minutes at a 30Hz/s frequency in a TissueLyser II grinder (Qiagen). DNA extraction of individual larvae was carried out using the QIAamp DNA Kit (Qiagen ...