Labshake search
Citations for Qiagen :
401 - 450 of 2622 citations for 6 Methyl 3 5 heptadien 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2019Quote: ... miRNAs were extracted from plasma (n=3 adults, n=3 weaned pups) using a miRNeasy Serum/Plasma kit (Qiagen #217184). Enriched fractions were sent to Macrogen (South Korea) ...
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Neuroscience 2022Quote: sMN total RNA from DHMN1 patient (n = 3) and controls (n = 3) was isolated using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was extracted from cell pellets as previously described (61), and all six RNA samples (3 acetate, 3 DIET) were cleaned with the RNeasy Mini Kit (Qiagen) and treated with Turbo DNA-free DNase (Ambion) ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... for 6 hours before RNA extraction using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3) QIAamp DNA Stool Mini Kit (QIAGEN®) and 4 ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Microbiology 2024Quote: ... The 3 PCR amplicons were gel purified (Qiagen), added in equimolar quantities ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4C (Qiagen, SI05163977), and 20 nM HIF1A Flexitube GeneSolution siRNA (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4B (Qiagen, SI00449764), 5 nM siKDM4C (Qiagen ...
-
bioRxiv - Genetics 2021Quote: ... 5 mM Multiplex-Kit (Qiagen) and HPLC water to a total volume of 10 μL per sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 uL EB buffer (QIAGEN) was added to each well and mixed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 μl RLT (79216, Qiagen) was added ...
-
bioRxiv - Microbiology 2020Quote: ... one well per condition was harvested and processed using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s instructions as noted above ...
-
bioRxiv - Molecular Biology 2019Quote: Real-time one-step reverse transcription quantitative PCR was performed with the QuantiTect Virus Kit (Qiagen, Foster City ...
-
bioRxiv - Neuroscience 2022Quote: Total RNAs (small and large RNAs) were extracted in one fraction with miRNeasy FFPE kit (Qiagen) following manufacturer’s protocol with minor changes ...
-
bioRxiv - Cancer Biology 2020Quote: An RNA probe targeting c-myb was generated using one-step RT-PCR (Qiagen, Manchester, UK) using the following primers c=myb-F 5’-CCAAGTCAGGAAAACGCCACCTCG-3’ and c-myb-R 5’-GCTGTTGTTTAGCGGAGTTGGGCT-3’ and cloned into the dual promoter vector pCRII-TOPO (Life Technologies) ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was isolated from NIH3T3 cells using the FastLane Cell One-Step Buffer Set (Qiagen). The mouse embryo brains at E10.5 were dissected in cold PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... One fifth of the total sample was used to purify RNA using miRNeasy kit (QIAGEN, 217004) and to calculate RNA enrichment ...
-
bioRxiv - Physiology 2022Quote: Approximately one-half of the powdered brain was homogenized in 1ml of QIAzol lysis reagent (Qiagen) and RNA was isolated using the Direct-zol RNA Miniprep Plus Kit (Zymo Research) ...
-
bioRxiv - Biochemistry 2022Quote: ... One microgram of total RNA was reverse transcribed into cDNA using QuantiTect Reverse Transcription Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.6 µM each XBP1 specific primers and one-step RT-PCR (QIAGEN OneStep RT-PCR, 210212). The PCR products were analysed by 2% agarose gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... One microgram of DNA was bisulfite-treated using the EpiTect 96 Bisulfite Kit (Qiagen GmbH, Germany). 200 ng of bisulfite-treated DNA was analysed using Infinium HumanMethylation 450K BeadChips (Illumina Inc. ...
-
bioRxiv - Genomics 2019Quote: ... DNA was extracted from leaves of one to two plants using a Qiagen MiniPrep Kit (Qiagen). Genotyping of all lines was performed using a custom lentil exome capture assay as described in Ogutcen et al ...
-
bioRxiv - Microbiology 2020Quote: ... CDNA fragments were amplified with strain-specific primers using the one step RT-PCR kit (Qiagen). Sequencing was performed by Macrogen Europe ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total RNA was isolated from one retina per fish using RNeasy Lipid/Tissue Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... One microgram of purified RNA was converted into cDNA using QuantiTect® Reverse Transcription Kit (Qiagen) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... One µg of genomic DNA was used for bisulfite conversion by using EpiTect Bisulfite Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... we extracted DNA from fresh tissue from one individual using the MagAttract HMW DNA Kit (Qiagen). Prior to library preparation ...
-
bioRxiv - Microbiology 2021Quote: ... All reactions were set up in triplicate using a One-Step RT-PCR kit (Qiagen, UK) as per the following run conditions ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was isolated from one HIP hemisphere by DNeasy Blood & Tissue Kit (Qiagen, catalog # 69504), the DNA quality was first confirmed by Nanodrop (ThermoFisher ...
-
bioRxiv - Genetics 2019Quote: One microgram of total RNA was reverse-transcribed into cDNA using QuantiTect Reverse Transcription Kit (Qiagen). As a control for genomic DNA contamination ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from one cerebellar hemisphere using the Qiagen miRNeasy Mini kit (Qiagen #217004). On column DNAse digestion (Qiagen #79254 ...
-
bioRxiv - Cancer Biology 2023Quote: RT-PCR was performed on the extracted RNA with One-Step RT-PCR kit (Qiagen, #210212) according to the manufacturer’s instructions and the following conditions ...
-
bioRxiv - Genomics 2023Quote: ... which were merged into one assembly using CLC-Bio Genomics Workbench De Novo Assembly (Qiagen, v11.0.1) with default parameters ...
-
bioRxiv - Genomics 2023Quote: ... and the BioSprint 96 one-for-all Vet Kit utilizing ASL buffer (19082; Qiagen, Germantown, MD) and bead beating ...
-
bioRxiv - Cancer Biology 2023Quote: ... genomic libraries were constructed from adductor muscle DNA from one individual cockle (DNeasy Tissue Kit, Qiagen), from Deep Bay ...
-
bioRxiv - Immunology 2024Quote: ... One μg of RNA was reverse-transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen) containing both oligo-dT and random primers.
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested 6 h post-transfection and the extracted RNA (RNeasy, Qiagen) reverse transcribed to produce cDNA (QuantiTect ...