Labshake search
Citations for Qiagen :
501 - 550 of 1651 citations for 6 METHYL 6 HEPTEN 4 YN 2 OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... at 4°C until DNA preparation using the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacture’s recommendation ...
-
bioRxiv - Microbiology 2022Quote: ... the Qiagen MagAttract PowerSoil DNA Isolation Kit (Cat#: 27000-4-KF; Qiagen, Carlsbad, CA), against five other extraction kits ...
-
bioRxiv - Cell Biology 2019Quote: ... incubated with Trizol for 5 min at 4°C and homogenized using TissuLyserTM (Qiagen) for 5 min at 50 Hz ...
-
bioRxiv - Microbiology 2019Quote: DNA isolation was performed using the MagAttract PowerSoil DNA Kit (Qiagen, # 27100-4-EP) on Eppendorf epMotion 5075 liquid handlers following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... and purified with the MiniElute PCR purification kit (QIAGEN, Cat. No. / ID: 28006×4). The purified genomic DNA fragments were end-repaired and had an A-tail added to the 3’ end ...
-
bioRxiv - Molecular Biology 2020Quote: ... thaliana were homogenised with zirconia beads YTZ-4 and TissueLyser II (Qiagen, Hilden, Germany), and total RNA was then extracted using the Maxwell 16 LEV Plant RNA Kit (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated at 4 °C overnight with Ni2+-nitrilotriacetic acid resin (Qiagen) pre-equilibrated with buffer B ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was collected and incubated with 4 ml of Ni-NTA agarose (Qiagen) for 2 hours at 4° C ...
-
bioRxiv - Cell Biology 2023Quote: ... pools of 3 x 103 MPP1-4 were sorted directly into RLT buffer (Qiagen) enriched with 1% of β-mercaptoethanol ...
-
bioRxiv - Cancer Biology 2023Quote: ... washed and RNA was extracted from 4×106 cells using the RNeasy kit (Qiagen) (performed in triplicate) ...
-
bioRxiv - Neuroscience 2023Quote: ... and tissue was homogenized at 4°C in a tissue lyser bead mill (Qiagen) for 2 min at 20 Hz ...
-
bioRxiv - Biophysics 2023Quote: ... for 4 h at 37 °C and purified with RNeasy Mini Kit (Qiagen; #74104). Following the in vitro transcription ...
-
bioRxiv - Biophysics 2023Quote: ... 4 °C and the supernatant was loaded onto a NiNTA column (Qiagen, Hilden, Germany) previously equilibrated with washing buffer (20 mM Tris pH 8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lysates were treated with 4 μl of Qiagen protease (QIAGEN, Hilden, Germany, #1017782,) at 56°C for 10 min ...
-
bioRxiv - Immunology 2023Quote: ... Larvae were euthanized at 4°C overnight and homogenized with a tissue lyser (Qiagen) at 1800 oscillations/min (30 Hz ...
-
bioRxiv - Bioengineering 2024Quote: ... and was then subjected to Ni-NTA affinity purification at 4 [(Qiagen, Valencia, CA). The column was adequately washed with 20 column volume of wash buffer containing 50 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... cfDNA was extracted from approximately 4□ml of plasma (QIAamp Circulating Nucleic Acid kit, Qiagen) and then constructed into sequencing libraries with end repair ...
-
bioRxiv - Genomics 2020Quote: Testis tissue was homogenized at 4°C in 1ml QIAzol Lysis Reagent (Qiagen, Hilden, Germany) together with RNase-Free Zirconium Oxide Beads (NextAdvance ...
-
bioRxiv - Genomics 2019Quote: ... cfDNA was extracted from 1 or 4 ml of urine according to manufacturer recommendations (Qiagen Circulating Nucleic Acid Kit ...
-
bioRxiv - Biophysics 2020Quote: ... 4 °C) and the supernatant was then incubated with 200 µl Ni-NTA (#30230, Qiagen) beads for 1 hour at 4 °C ...
-
bioRxiv - Genetics 2019Quote: ... 4 μl of PCR products were subsequently added to 21 μl PyroMark Master Mix (Qiagen) containing 10 pmol of barcoded primers (adapted from NEXTflexTM 16S V1-V3 Amplicon Seq Kit ...
-
bioRxiv - Genomics 2020Quote: ... 4 μl of pooled products were subsequently added to 21 μl PyroMark Master Mix (Qiagen) containing 10 pmol of barcoded primers (adapted from NEXTflexTM 16S V1-V3 Amplicon Seq Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 °C) and the supernatant was then loaded onto 1 ml HisTrap HP column (Qiagen) at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The soluble cell lysate fraction was loaded on a 4 mL Ni-NTA column (QIAGEN) pre-equilibrated with binding buffer ...
-
bioRxiv - Physiology 2021Quote: Total RNA was purified from embryos at 4 dpf using an RNeasy micro kit (Qiagen) with DNase I ...
-
bioRxiv - Neuroscience 2022Quote: ... we used 4 columns to purify product following the MinElute PCR Purification Kit manual (Qiagen). DNA from each column was eluate using 25 μL EB buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Clarified lysate was then incubated for one hour at 4 °C with Ni-NTA (Qiagen) in batch adsorption format ...
-
bioRxiv - Bioengineering 2022Quote: ... 350 µL of NucleoSpin RNA extraction buffer along with 4-5 ceramic beads (Qiagen 13113) were added 14into the tube ...
-
bioRxiv - Molecular Biology 2020Quote: ... 30 cycles) and the 170bp band purified on a 4% agarose gel (Qiagen gel purification). Fragments were extended with homology arms (Table 1 ...