Labshake search
Citations for Qiagen :
101 - 150 of 5045 citations for 6 Isoquinolinol 1 4 5 dimethoxy 2 5 6 6a 7 tetrahydro 1 2 10 trimethoxy 6 methyl 4H dibenzo de g quinolin 9 yl oxy phenyl methyl 1 2 3 4 tetrahydro 7 methoxy 2 methyl S R* R* 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... placed into a 2 mL tube with 600 μL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989), then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: Liver tissue was homogenized in chloroform/methanol (2:1, 1 mL) using TissueLyser (Qiagen Ltd., Manchester, UK). Deionized water (400 uL ...
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293 cells were transfected with 1:1:2 μg of packaging plasmids versus shRNA hairpins on the pLKO.1 vector using Effectene transfection reagent (Qiagen) 48 h prior to harvesting supernatants ...
-
bioRxiv - Cell Biology 2023Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 5 or 6 Transwells using the RNeasy Micro Plus kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-6 cryosections were also collected for RNA extraction using RNAeasy Micro kit (Qiagen, 74004). Quality of the RNAs was determined by Tapestation (Agilent ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Bioengineering 2020Quote: ... with 1% 2-Mercaptoethanol (Serva) and disrupted using the Qiagen Tissue Ruptor (Qiagen). Total RNA was extracted using the RNeasy Fibrous Tissue Mini Kit (Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: ... bron-1 and bron-2 root tips using the RNeasy Micro Kit (Qiagen). qPCR was performed with SYBR green (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: 2 □ 107 spores were mixed with 1 ml RNAlater RNA stabilization reagent (Qiagen) and centrifuged at 17,000 g for 5 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of bisDNA was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 2 μl of 10 μM primer mix (Methods Table 1) ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated for 2 h at 4 °C with Ni2+-NTA-agarose (Qiagen) (20 mg of proteins/ml of resin ...
-
bioRxiv - Immunology 2021Quote: ... Skin samples were homogenized in a TissueLyser LT (Qiagen, 50 Hz, 2 times 4 minutes) using 5 mm stainless steel beads (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
FGF signalling is involved in cumulus migration in the common house spider Parasteatoda tepidariorumbioRxiv - Developmental Biology 2021Quote: CLC Main Workbench 7 (QIAGEN Aarhus A/S) was used to perform a local tBLASTn [25] against the Parasteatoda tepidariorum official AUGUSTUS gene set (https://i5k.nal.usda.gov/Parasteatoda_tepidariorum ...
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Systems Biology 2022Quote: ... Ten millilitres of culture were pelleted by immediate centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations) at 50 Hz using a TissueLyser LT (Qiagen). Thereafter ...
-
bioRxiv - Genetics 2022Quote: ... and non-inoculated G305-3M leaf segments collected along 10 different time points (0, 3, 6, 9, 12, 16, 24, 36, 48, 72 hpi) using the RNeasy Plant Mini Kit (Qiagen, Germany). The cDNA was synthesized from total RNA using a qScript™ cDNA Synthesis Kit (Quantabio ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1 mL of stabilization mix (RNAprotect Bacteria Reagent - Qiagen diluted with PBS in a 2:1 volume ratio) was applied on plates ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131) overnight ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 (2×106 cells/well) using the RNeasy Mini Kit (Qiagen) with DNase I treatment to eliminate DNA contaminants as previously described18 ...
-
bioRxiv - Microbiology 2023Quote: Cellular RNA of 2-5×105 cells was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
Epigenetic Effects of Exposure to Insecticide on Early Differentiation of Mouse Embryonic Stem CellsbioRxiv - Pharmacology and Toxicology 2019Quote: DNA methylation was evaluated using an EpiTect Methyl II DNA Kit provided by Qiagen (Chatsworth, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... for the PCR analysis of potential recombination events genomic DNA from 1×10^6 cells was extracted using DNeasy Blood & Tissue Kits (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 mL cultures were immediately added to centrifuge tubes containing 4 mL RNAprotect Bacteria Reagent (Qiagen), vortexed for 5 seconds and incubated at room temperature for 5 min ...
-
bioRxiv - Genomics 2021Quote: cfDNA was extracted from 2-4 mL of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... rotated at 4°C for 1.5-2 hr in 0.75 mL equilibrated Ni-NTA Agarose (Qiagen), followed by packing pre-equilibrated Poly-Prep Chromatography Columns (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from 1-2 million cells using RNeasy Mini Kit (QIAGEN) using QIAcube (QIAGEN) ...
-
bioRxiv - Paleontology 2019Quote: ... plasmid minipreps were purified with a QIAprep Miniprep Kit (Qiagen, chimpanzee 1 and 2), and RBC Miniprep Kit (YPD100 ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mL of each culture was added to 2 mL RNAprotect Bacteria Reagent (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... Following a 2-hour RNase A treatment (Qiagen, 100 mg/ml, 1:1,000 dilution) at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from 4-6 dpf zebrafish larvae using the RNeasy Plus Micro Kit (Qiagen). cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... 1 mL of the 2-mL culture was removed and replaced by 1 mL of RNAprotect Cell Reagent (Qiagen). After 5 min of incubation ...
-
bioRxiv - Microbiology 2022Quote: ... 200 RPM for 2 h then approximately 1×109 CFU of bacteria were mixed at a 2:1 (vol:vol) ratio of RNAProtect (Qiagen) and incubated at room temperature for 5 min ...
-
bioRxiv - Microbiology 2023Quote: TG was quantified in snap-frozen liver tissue stored at −80 □C until cryo-grinding in liquid nitrogen and 50 ±5 mg tissue added 0.9 mL of a 2:1 chloroform:methanol solution and homogenized 1 min at 50 os/sec using a TissueLyser LT (Qiagen) with beads ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA from 18 ONS cell samples (6 AD patients, 6 MCI and 6 HC) were extracted using Allprep universal kit (Qiagen cat. no. 80224). RNA-seq libraries were prepared using the Illumina TruSeq Stranded Total RNA library Prep Gold Kit (Illumina 20020598 ...
-
bioRxiv - Genetics 2019Quote: ... for lysis in 2 ml safe-lock tubes containing one 5 mm stainless steel bead (Qiagen) for 2.5-3 minutes at 30 Hz using TissueLyzer II (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 h time points were immediately mixed with 2 x volume of RNAProtect® (Qiagen) using the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNAs used were RAPH1 siRNA #2 (Hs_RAPH1_2, SI00698642) and RAPH1 siRNA #5 (Hs_RAPH1_5, SI04300982) provided by Qiagen.
-
bioRxiv - Cancer Biology 2023Quote: Each qPCR reaction consisted of 5 μL of 2× QuantiNOVA SYBR Green PCR master mix (Qiagen), 0.5 μL of 10 μM forward and reverse primers each ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Oligomerization state of the functional bacterial twin arginine translocation (Tat) receptor complexbioRxiv - Biophysics 2021Quote: ... The supernatant was loaded onto a 10 x 1 cm column with 2 mL Ni-NTA Superflow resin (Cat. #30230, Qiagen) that was pre-equilibrated with Buffer A (10 mM CAPS ...