Labshake search
Citations for Qiagen :
601 - 650 of 2648 citations for 6 Fluoro 1 3 benzodioxene 8 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: The validated Alx1DN (N-terminal portion of protein product containing homeodomain and nuclear localization domains) clones in pCS2+8 were purified via miniprep (Qiagen) alongside a control (C-terminal portion containing transactivation domain) ...
-
bioRxiv - Genetics 2019Quote: ... in each well of 8-stripped PCR tubes by shaking with a zirconia bead (2 mm in diameter, Nikkato, Japan) in TissuLyser II (Qiagen) for 30 s at 30 Hz ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was harvested following an 8 hour DMSO or 10 nM E2 induction with buffer RLT plus (Qiagen, 1053393) supplemented with 1% beta-mercaptoethanol (Sigma Aldrich ...
-
bioRxiv - Genetics 2022Quote: ... 8 cm of leaf tissue was harvested on ice and then lyophilized using a TissueLyser II (Qiagen, Valencia, CA, USA). Genomic DNA was extracted using a Qiagen DNeasy Plant Mini Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: RNA from frozen FC area 8 was extracted following the supplier’s instructions (RNeasy Mini Kit, Qiagen® GmbH, Hilden, Germany). RNA integrity and 28S/18S ratios were determined with the Agilent Bioanalyzer (Agilent Technologies Inc ...
-
bioRxiv - Microbiology 2023Quote: ... pH was adjusted to 8 after resuspension to allow the binding of 6x His-tagged toxins to Ni-NTA agarose resin (reference: 30210; Qiagen). Resulting samples were passed through chromatography columns containing the Ni-NTA agarose resin and were eluted with denaturing buffer containing increasing concentrations of Imidazole (10 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was isolated from Arabidopsis seedlings (8 seedlings per sample) using the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) 24 h after the elicitor treatment ...
-
bioRxiv - Microbiology 2023Quote: ... and RNAI were amplified by PCR (primer sequences are listed Supplementary Table 8) and PCR products were analysed by 2 % agarose gel electrophoresis and purified using the QIAquick PCR purification kit (QIAGEN). 5’-triphosphate (PPP ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated as previously described.8 The cDNA and purified viral DNA were used for quantitative PCR (qPCR) using QuantiTect probe PCR master mix (Qiagen) and optimized concentrations of forward primer (TGTGTGGGAGACCATCAAGC) ...
-
bioRxiv - Microbiology 2023Quote: ... an unbiased amplification method was employed by amplifying the purified DNA at 30°C for 8 hours using a REPLI-g Single Cell kit (Qiagen). The amplified DNA was purified using AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Genomics 2023Quote: ... After ligation nuclei were pelleted and resuspended in cold PBS with DAPI to a final concentration of 300nM and GFP+ cells were FAC-sorted into a 96 well plate with 2ul lysis buffer (20mM Tris pH 8, 20mM NaCl, 0.15% Triton X-100, 25mM DTT, 1mM EDTA, 500nM Carrier ssDNA, and 15ug/mL Qiagen Protease) and lysed for 1 hour at 50°C and inactivated 15 minutes at 70°C ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was isolated from flash frozen 8 μm thick sections of tibialis anterior muscles embedded in OCT using the RNeasy Mini Kit (Qiagen) and evaluated using the RNA high sensitivity kit (Agilent RNA 6000 Pico Kit ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 75 ng of rRNA was reverse transcribed and amplified with 8 PCR cycles using the OneStep RT-PCR kit (Qiagen) and primers MS2_quant_F and MS2_quant_R (Supplemental Table 5) ...
-
bioRxiv - Microbiology 2024Quote: ... samples were resuspended in 100 μl TE buffer pH 8 and RNA extraction performed according to the RNeasy Mini Kit (Qiagen) protocol with few modifications ...
-
bioRxiv - Biochemistry 2023Quote: ... SUMO protease was added at a final concentration 1/10 and the mixture was dialyzed overnight at 4 °C against the buffer DB6 (50 mM Tris-HCl pH 8, 150 mM NaCl, 10 mM imidazole) and applied on a NiNTA column (Qiagen) equilibrated in the DB6 buffer ...
-
bioRxiv - Developmental Biology 2019Quote: RNA was extracted from pools of 6 × 105 FACS-isolated cells using the miRNeasy Micro Kit (Qiagen). Quantification of total RNA was performed by Qubit® RNA BR Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected in 10 cm2 or 6-well plates at ∼60% confluency using PolyFect (Qiagen 301107) and washed with complete media 6 h later.
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA (at least 6 μg) was extracted using the RNeasy Plant Mini kit (Qiagen, Hilden, Germany), with an additional step to remove contaminating DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... 6 and 48 HAT to ammonium or nitrate amended plates using RNeasy® Plant Mini kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was isolated from 5-6 replicated lung slices from each treatment using miRNeasy Mini Kit (Qiagen) at time 0 and time 120 hours for all groups ...
-
bioRxiv - Molecular Biology 2020Quote: SH-SY5Y cells plated in 6-well plates were lysed using 750ul of QIAzol Lysis reagent (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... GAS and SOL muscles from 6 mice per group were pulverized and lysed in RLT buffer (Qiagen) and treated with proteinase K (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... qPCR cycles were run as described elsewhere 6 but using a Rotor Gene-Q instrument (QIAGEN, GER). To quantify the relative abundance of Cori and ter chromosomal regions in each sample ...
-
bioRxiv - Immunology 2022Quote: BMDMs were grown in 6-well plates and RNA was isolated using the RNeasy Mini kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: Total RNA from cardiomyocytes was obtained on day 6 post adenovirus infection using the RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from cortical neurons on 6 cm dishes using RNeasy Plus Mini Kit (QIAGEN, 74134) and reverse-transcribed using SuperScript II (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: Amplification was carried out in a Rotor Gene thermocycler 6-plex with Quantitect Multiplex PCR kit (Qiagen) with 0,24μM of each primer y 0,25μM of each probe under the following conditions ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from 4-6 dpf zebrafish larvae using the RNeasy Plus Micro Kit (Qiagen). cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Bioengineering 2023Quote: ... gDNA was purified from cells in 6-well plates using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Fibroblasts were grown to confluency in 6-well plates and total RNA extracted using RNeasy Kit (Qiagen). Poly(A)-tailed RNA enrichment and library construction was performed using KAPA stranded mRNA-Seq Kit with KAPA mRNA capture beads (KAPABiosystems) ...
-
bioRxiv - Biophysics 2020Quote: ... proteins were expressed in Escherichia coli strain BL21 (DE3) and purified via nickel-nitrilotriacetic acid affinity chromatography (Qiagen) followed by ion exchange chromatography on an Äkta system (GE Healthcare) ...
-
bioRxiv - Genomics 2020Quote: Nucleic acids were isolated from 4 mL of plasma by using a QIAamp cfDNA/RNA kit (Qiagen 55184) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2 mL of plasma were thawed and cfDNA extracted using the QIAamp® Circulating Nucleic Acid Kit (Qiagen) according to the manufacturer’s protocol and stored at −20°C until use ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were transfected with 12.5 or 6.25nM locked nucleic acid (LNA) miRNA inhibitors (miR-194 LNA inhibitor or negative control inhibitor; Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acids were extracted using QIAamp 96 virus Qiacube HT kit on QIAxtractor Automated extraction (Qiagen, US) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... Nucleic acids were isolated via chloroform extraction and RNA was isolated with the Qiagen RNEasy Mini (Qiagen #74104) including on-column DNase I digestion ...
-
bioRxiv - Microbiology 2020Quote: ... Total nucleic acid was extracted from 140 ul of sample fluid using the QIAamp RNA Viral kit (Qiagen) and eluted with 30 ul of DEPC-treated water ...
-
bioRxiv - Microbiology 2020Quote: Nucleic acids were extracted from mouse fecal samples and inoculum samples using the DNeasy Powersoil HTP Kit (QIAGEN) and from the further simplified SC2 samples using the Powermag Microbiome kit (MoBio) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5% deoxycholic acid with a protease inhibitor) and pre-cooled tissue homogenizer (TissueLyser LT, Qiagen GmbH, Hilden, Germany) for 2-4 min at 45 Hz ...
-
bioRxiv - Microbiology 2019Quote: ... followed by a standard nucleic acid extraction method using QIAamp genomic DNA Mini Kit (Qiagen Sciences, Maryland, USA), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: RNA was extracted from up to 500 μl of plasma using QIA amp Circulating Nucleic Acid Kit (Qiagen) and eluted in 15 μl volume ...
-
bioRxiv - Genomics 2021Quote: ... cfDNA was isolated from 2 ml of plasma using either the manual QIAamp circulating nucleic acid kit (Qiagen), or the semi-automated QIAsymphony DSP Circulating DNA Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 700 μl of the supernatant was mixed with 30 μl of nickelnitrilotriacetic acid-agarose (Ni-NTA, Qiagen) for 2 h at RT with mild rotation ...
-
bioRxiv - Cell Biology 2022Quote: ... and the soluble fraction of the lysate was incubated with Ni2+-nitrilotriacetic acid (NTA) beads (Qiagen, Hilden, Germany). Proteins were eluted with 300 mM imidazole in 60 mM NaH2PO4 ...
-
bioRxiv - Microbiology 2023Quote: Total nucleic acids were extracted from half of each sample’s O.2μm filter using DNAeasy PowerSoil Kit (Qiagen). Extraction blanks were run with each round of DNA extractions and all returned no detectable nucleic acids using the maximum amount of blank sample (20μL ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was filtered through a 0.45 μm filter and loaded on a nickel-nitrilotriacetic acid column (Qiagen) pre-equilibrated with lysis buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged talin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a gel filtration column (Superdex 200 ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged vinculin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a Q-Sepharose ion exchange column ...
-
bioRxiv - Microbiology 2023Quote: ... Viral nucleic acids were extracted using the QIAMP® Viral RNA mini kit (60 µL, Qiagen, Venlo, Netherlands) without the addition of carrier RNA ...
-
bioRxiv - Neuroscience 2023Quote: ... Deoayribonucleic acid (DNA) was extracted from stored buffy coat using the Blood Mini DNA kit (Qiagen, Valencia, CA). A TaqMan® single nucleotide polymorphism (SNP ...