Labshake search
Citations for Qiagen :
201 - 250 of 2557 citations for 6 Chlorotetrazolo 1 5 b pyridazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Cells were then harvested by centrifugation (5 min, 10,000 × g) and immediately suspended in 1 mL bacterial RNA protect (Qiagen, Germantown, MD), followed by 5 min incubation at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... The 319 bp DNA size of PCR products were clarified by 1% agarose gel electrophoresis using 5 μL PCR products and remained DNA were purified by QIAquick PCR Purification Kit (Qiagen, 28104). The purified PCR products were sequenced by Sanger Sequencing approach (GeneWiz ...
-
bioRxiv - Genetics 2020Quote: ... suspended in 1 mL of (v/v) 50% ACN and homogenized in a bead mill (50 Hz, 5 min; TissueLyser LT, Qiagen, Germany) using two 5 mm tungsten balls ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 6 µM and harvested 24 h later by adding RLT lysis buffer (Qiagen). Similarly ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue from 6 brains were pooled to prepare total RNA (RNEasy micro kit, Qiagen) for reverse transcription and amplification to cDNA (Ovation Pico WTA kit ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 mL of culture were mixed with 6 mL of RNAprotect bacteria reagent (Qiagen) and processed according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and harvested for RNA extraction after 6 hours of incubation using RNAeasy kits (Qiagen). cDNA was synthesized from 500 ng of RNA using Quantitect Reverse Transcriptase kits (Qiagen) ...
-
bioRxiv - Genetics 2019Quote: HEK293Ts were plated in 6 well plates and transfected using Effectene Transfection Reagent (Qiagen) according the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... IL −6 and TNFα mRNA were detected by validated QuantiTect primer assays 144 (Qiagen).
-
bioRxiv - Biophysics 2023Quote: TSA measurements were carried out on a Rotor-Gene Q 6 plex (Qiagen, Germany) instrument at a heating rate of 2 °C/min and a temperature range of 25−90 °C in the presence of a CPM dye ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 nM siRNAs were mixed with 6 µl of HiPerFect transfection reagent (Qiagen, #301707) in 100 µl of serum free DMEM and added to freshly plated cells drop by drop ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Immunology 2021Quote: RNA was prepared from sorted GC B cells and LNPCs from FNA or enriched BMPCs from bone marrow using the RNeasy Plus Micro kit (Qiagen). Libraries were prepared using the NEBNext Immune Sequencing Kit for Human (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNAs of tet(X)-positive isolates were extracted by using Puregene Yeast/Bact Kit B (Qiagen, Gaithersburg, MD, Germany) according to the instruction of the manufacture ...
-
bioRxiv - Microbiology 2022Quote: ... Cytochrome b products were excised and purified from the gel using a commercial kit (QIAquick Gel Extraction Kit, Qiagen, Germany), followed by purification of eluted DNA using AMPure XP Magnetic Beads (1X ...
-
bioRxiv - Biochemistry 2020Quote: ... resuspended in buffer A supplemented with 8 M guanidine hydrochloride (= buffer B) and loaded onto an Ni-NTA agarose column (QIAGEN) pre-equilibrated in the same buffer ...
-
bioRxiv - Immunology 2019Quote: ... Two times 2.5 × 105 of naive B cells (CD20+IgM+IgD+IgG−) were sorted and subjected to RNA isolation (RNeasy Micro Kit; Qiagen). Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends ...
-
bioRxiv - Immunology 2020Quote: ... b is the intercept-y of the standard curve and m is the slope of the standard curve (QIAGEN, 2014). Subsequently ...
-
Intrarenal B cells integrate in situ innate and adaptive immunity in human renal allograft rejectionbioRxiv - Immunology 2020Quote: ... and CD45+ Calcein+ DAPI-CD19+ CD38+ activated B cells were single-cell sorted into 96-well plates with catching buffer (RLT lysis buffer (Qiagen) with 1% 2-mercaptoethanol (Sigma-Aldrich)) ...
-
bioRxiv - Immunology 2021Quote: Total RNA from sorted GC B-cells of immunized WT and CD22KO mice was extracted using an RNeasy micro kit (Qiagen). Indexed cDNA libraries were generated using a SMART-Seq Stranded kit (Takara Bio ...
-
bioRxiv - Immunology 2021Quote: ... total RNA was isolated from 0.4×106 FACS-sorted B220hi CD138- and B220low CD138+ B cells (derived from 3 biological replicates after eight days in culture) using the RNeasy Mini Kit (Qiagen). cDNA was generated from polyadenylated transcripts employing the SMART-Seq v4 ultra low input RNA kit (Takara Bio) ...
-
bioRxiv - Immunology 2022Quote: 2 × 103 to 1 × 105 sorted B cells per sample were centrifuged at 800g for 8min and total RNA was extracted using RNeasy Micro Kit (Qiagen) following the recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... SEV and CTRL) at endpoints A and B (total of 30 samples) was extracted with QIAamp DNA Blood Mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to 2 ml lysis matrix B tubes (MPBio) and subjected to bead beating for 15 min at 30 Hz (Tissuelyser II, Qiagen) with RNAse A added ...
-
bioRxiv - Immunology 2024Quote: ... of either the B cell clone or polyclonal B cells of the patients were directly FACS sorted into 100µL ALT lysis buffer (Qiagen MicroKit). gDNA was extracted as per manufacturer’s instructions (Qiagen MicroKit) ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was isolated from FACS-sorted B220low/CD19+ splenocytes from sick mice (B-cell lymphoma only) using an RNeasy Micro kit (Qiagen). Control RNA was isolated from normal B220high/CD19+ splenocytes from control healthy mice that had also received pIpC and SRBC injections similarly to the experimental mice ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was isolated from FACS-sorted B220low/CD19+ splenocytes from sick mice (B-cell lymphoma only) using a RNeasy Micro kit (Qiagen). Control RNA was isolated from normal B220high/CD19+ splenocytes from control healthy mice that also received pIpC and SRBC injections similarly to the experimental mice ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were homogenized in 1 ml cell culture medium (see above) and a 5 mm steel bead in a TissueLyser (Qiagen, Hilden, Germany). Fecal samples were vortexed in sterile NaCl and the supernatant was sterile filtered (22µm ...
-
bioRxiv - Immunology 2020Quote: YFP+ Treg cells were sorted from spleen and LN of WT or Usp22fl/flFoxp3YFP-Cre mice (n=5 per group) and total RNA was isolated from 1×106 cells per sample using an RNeasy Mini Kit (Qiagen, Cat# 74104) as previously described47 ...
-
bioRxiv - Genetics 2020Quote: ... 30 mg of snap frozen tissues were processed adding 1 ml of QIAzol reagent in presence of one 5 mm stainless steel bead (Qiagen, Hilden, Germany). Total RNA isolation from homogenized tissues was performed using Qiagen RNeasy kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and isolated keratinocytes and fibroblasts from the skin and Wound7 (n = 5/each group) (Table 1 and Table S1) by using the miRNeasy Mini kit (Qiagen, Hilden, Germany) and prepared for library construction ...
-
bioRxiv - Cancer Biology 2023Quote: ... we adapted the same conditions used in Dip-C40 and lysed each nucleus in 150 nL of lysis buffer containing 20 mM Tris pH8/20 mM NaCl/25 mM DTT/0.15% Triton X-100/1 mM EDTA/5 µg/mL Qiagen Protease (Qiagen, cat. no. 19157). After dispensing ...
-
bioRxiv - Immunology 2024Quote: Genomic DNA was then isolated from 1-5 million isolated PBMCs using the DNeasy Blood and Tissue kit (Qiagen; Cat. No. 69504) following manufacturer instructions ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...