Labshake search
Citations for Qiagen :
301 - 350 of 1786 citations for 6 Chloro N ethyl 2 methylthio 4 pyrimidinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from cells in 6 cm dishes using the RNeasy kit (Qiagen # 74106) according to manufacturer instructions ...
-
bioRxiv - Immunology 2022Quote: ... corpus (segment 6-7) and cauda (segment 8-10) samples using QIAzol Lysis Reagent (Qiagen) following the manufactureŕs recommendation using a bead-based tissue homogenizer (Retsch ...
-
bioRxiv - Molecular Biology 2023Quote: S2 cell transfections were carried out in 6-well plates using Effectene transfection reagent (Qiagen). Each well was transfected with 1 μg of the pAc5.1-λN-HA:dFMRP and 1 μg pAFW-AGO1 or pAFW-GW182 plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: S2 cell transfections were carried out in 6-well plates using Effectene transfection reagent (Qiagen). Each well was transfected with 1 μg of the pAc5.1-EGFP:dFMRP and 1 μg of pAc5.1-mCherry plasmids containing DCR1 ...
-
bioRxiv - Immunology 2023Quote: ... muris isolates (6 in total) were extracted via a DNeasy Blood and Tissue kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with guide RNAs for Rme-6 knockdown using Polyfect Transfection reagent (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... High speed supernatant was combined with 6 mL of Ni-NTA Agarose (Qiagen, Cat# 30230) and stirred in a beaker for 1-2 hour(s ...
-
bioRxiv - Microbiology 2024Quote: ... 1.5x105 Acanthamoeba castellanii cells were transfected with 6 μg of linearized plasmid using Polyfect (QIAGEN) in phosphate saline buffer (PBS) ...
-
bioRxiv - Cancer Biology 2022Quote: ... paraffin-embedded (FFPE) 4 × 4 μm tissue sections of primary tumors and matched brain metastases using RNeasy FFPE kit (Qiagen, Hilden, Germany) per manufacturers’ instructions ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Immunology 2020Quote: ... Samples were diluted at 4:1 (elution buffer (Qiagen)/cDNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Samples were treated with 4 μL Rnase A (Qiagen) to eliminate RNA contamination ...
-
bioRxiv - Cell Biology 2019Quote: ... Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′; Qiagen SI00176057), and non-target (NT ...
-
bioRxiv - Biochemistry 2019Quote: ... 3-4 mL of Ni-NTA superflow resin (Qiagen) were loaded onto a column and equilibrated with the resuspension buffer ...
-
bioRxiv - Genomics 2019Quote: ... the Qiagen PowerMag kit (Qiagen, Cat# 27500-4-EP) was used for robot extractions while the Qiagen DNeasy PowerSoil kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... ears are collected on day 4 in RNAlater (Qiagen) and stored at 4° C until processed ...
-
bioRxiv - Cancer Biology 2023Quote: ... was lysed using 4% SDS and a qiashredder (Qiagen) and analyzed by Western blot.
-
bioRxiv - Neuroscience 2023Quote: ... into 4 μl Buffer TCL (1,031,576; Qiagen, Venlo, Netherlands) plus 1% 2-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 µl of 5X PCR buffer (Qiagen; Hilden, Germany), 0.8 µl of 10 mg/ml BSA (Promega ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was extracted from appropriately staged embryos or whole larvae (n=10 /sample) using the RNeasy Plus Universal mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from heparinised blood of SI and SH mice (n=3 per housing group) using the RNeasy Protect Animal Blood Kit (Qiagen). Extracted RNA was hybridised at UCL genomics following standard Affymetrix protocols ...
-
bioRxiv - Molecular Biology 2020Quote: Whole blood samples from 10 healthy volunteers (n = 5 females and n = 5 males) aged from 25 to 37 were collected into PAX gene RNA blood tubes (Qiagen). Total RNA samples were isolated using QIAcube automation with the PAXgene Blood miRNA Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... PRRSV-2 RNA was used to amplify cDNA encoding the full-length of N gene by RT-PCR (One-step RT-PCR, QIAGEN) using specific primers with the forward containing a T7 promoter sequence at the 5’ end ...
-
bioRxiv - Microbiology 2019Quote: ... coli BL21 (DE3) as fusion proteins containing an N-terminal His6- tag and purified by immobilized metal-affinity chromatography (Ni-NTA, Qiagen). Full-length DosR was also expressed with N-terminal GST-tag ...
-
bioRxiv - Microbiology 2020Quote: DNA extractions from the 8-week fecal samples (n = 8 per group) were performed using the Qiagen QIAmp DNA stool extraction kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA from ∼250,000 neurons per sample (n = 3 samples per group) was extracted and purified (DNeasy Blood and Tissue DNA extraction kit, Qiagen) prior to RRBS (Ovation RRBS Methyl-Seq System ...
-
bioRxiv - Biophysics 2020Quote: ... All the constructs also contain a His6-tag at the N-terminus for affinity purification with Nickel-NTA agarose beads (Qiagen). Site-directed mutagenesis was performed using the QuickChange Lightning kit (Agilent Technology) ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant protein fragments were produced in Escherichia coli (strain M15) as fusion products with an N-terminal tag of six histidines using plasmid pQE30 (Qiagen) and purified from total bacterial lysates by nickel affinity chromatography ...
-
bioRxiv - Cancer Biology 2022Quote: Spheroid and monolayer samples (technical replicates n=3) of MUC-1 and NCI-H295R cells were processed for RNA extraction using the RNeasy Mini kit (Qiagen), followed by DNA removal (TURBO DNA-free™ Kit ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from single-cell clone or bulk GFP+ and GFP- cells (n = 3 with cells from three different mice in each group) using QIAzol lysis reagent (Qiagen). DNA was removed using the RNase-Free DNase Set (QIAGEN) ...
-
bioRxiv - Neuroscience 2019Quote: ... was extracted from P7 dissected neocortices separated from meninges of Ctrl and Nr2f1cKO mice (n=3) using the RNeasy Mini kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... total RNA was extracted from control and INPP5ED477N/D477N organoids (n=3 samples per genotype) using an RNeasy Plus Micro Kit (Qiagen) and reverse transcribed using Superscript™ IV VILO™ Master ezDNase enzyme (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2020Quote: ... Cells were transiently transfected with cDNA encoding the mouse Piezo1 channel or its mutants tagged with GFP on its N-terminus in the pCDNA3 vector using the Effectene reagent (QIAGEN). Cells were then trypsinized and re-plated on poly-D-lysine-coated round coverslips 24 hours after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... and digested DNA products were extracted from the agarose gel using the QIAquick Gel Extraction kit (QIAGEN, cat. n° 28704), according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... Cell debris were removed by centrifugation (35,000 g at 4°C for 20 min) and the N-terminal His-tagged proteins were purified from the supernatant using NiNTA agarose (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was extracted and purified from pooled scrambled control and genotyped cldn7b F0 knockout larvae (n=50 per group) at 7dpf using the RNeasy Plus Micro Kit (QIAGEN), followed by cDNA synthesis with the SuperScript IV VILO Master Mix Kit (ThermoFisher) ...
-
bioRxiv - Genomics 2019Quote: Genomic DNA was extracted from fin clip samples (n=768 fish) using the commercial kit DNeasy Blood & Tissue Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... These plasmids were purified and DNA extracted using QIAGEN Plasmid Midi Kit (100) (cat. n° 12145, QIAGEN, Valencia, CA, USA), according to manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 21 days following X-ray exposure we extracted the total RNA (RNeasy® mini kit, Qiagen, cat. n. 74104) from 3 sponges for each treatment and control ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant proteins were then separated from the His-tagged TEV protease (and the cut N-terminal portion) by gravity-flow separation on Ni-NTA agarose (Qiagen). Finally ...