Labshake search
Citations for Qiagen :
201 - 250 of 3606 citations for 6 Chloro 5 6 dihydroimidazo 1 5 a pyrido 3 2 e pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 5 μL 10X PCR buffer (Qiagen), and nuclease-free water to a final volume of 50 μL ...
-
bioRxiv - Genomics 2021Quote: ... containing 5 µl RLT plus (Qiagen) with 1% v/v β-mercaptoethanol (Biorad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with one 5 mm (Qiagen, 69989) and three 2.8 mm metal beads (Precellys ...
-
bioRxiv - Genetics 2021Quote: ... and E11 (5’-AGGAAAAAGGAAATAAATTA-3’) primers on pDH373 as a template generated a smaller fragment that was cleaned up by QIAGEN MinElute PCR Purification Kit (#28004) ...
-
bioRxiv - Developmental Biology 2021Quote: ... E18.5 RNA was extracted from cortices of 3 genotypic conditional knockouts and 4 controls using the RNeasy Micro Kit (Qiagen). RNA was reverse transcribed to cDNA using the SuperScript™ II Reverse Transcriptase Kit (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... LRRCC1-si2 (target sequence: 5’- TTA GAT GAC CAA ATT CTA CAA - 3’) and control siRNA (AllStars Negative Control) were purchased from Qiagen. siRNAs were delivered into cells using Lipofectamine RNAiMAX diluted in OptiMEM medium (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs used were: AllStars Negative control siRNA (cat# 1027281) and si-Rab13 #8 (cat# SI02662702; target sequence: 5’-ATGGTCTTTCTTGGTATTAAA-3’) from Qiagen.
-
bioRxiv - Microbiology 2020Quote: ... All samples were then passed 3-5 times through a 26G needle prior to RNA isolation using the RNAeasy mini kit from Qiagen. RNA concentrations were estimated by absorbance measurement at 260 and 280 nm ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Pathology 2021Quote: ... DNA was extracted from epidermal tissue (approximately 3 - 5 mm2 per lesion) using a DNAeasy blood and tissue kit (Qiagen). Regressed and CsA group mice were culled at day 133 post-infection ...
-
bioRxiv - Genetics 2021Quote: ... and 99F8 (150 ng pU6-3-99F8-gRNA (DGRC Cat# 1549) and 150 ng pBS-99F8-5’HR-attP>>Act5C::GFP<
3’HR) loci using Effectene Transfection reagent (QIAGEN) as per the manufacturer’s recommendation ... -
bioRxiv - Cell Biology 2021Quote: Formalin-fixed paraffin-embedded tissues were used for in situ hybridization (ISH) employing locked nucleic acid (LNA) probes labelled with digoxigenin (DIG) at both the 5′- and 3’-ends (Qiagen). ISH was performed with probes specific for miR-132-3p (10 nM ...
-
bioRxiv - Developmental Biology 2022Quote: A repair template containing TagRFP-T::AID with homology at the 5’ and 3’ ends to the egl-43 locus was PCR amplified and purified using a PCR purification kit (Qiagen). 3 μl of 10 μM tracRNA (IDT ...
-
bioRxiv - Genomics 2022Quote: ... were annealed (10 μL each 100 μM) to 10 μL 5′-[Phos]-CTGTCTCTTATACACATCT-3’ oligonucleotide (100 μM) within 80 μL EB buffer (Qiagen), incubating 2 min at 95°C and cooled to room temperature (0.1°C/sec) ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from 3-5 mm ear primordia of the inbred line B73 using RNeasy Mini Kit (Qiagen) with on-column DNase I (Qiagen ...
-
bioRxiv - Genomics 2023Quote: ... Second strand synthesis was performed after thawing by the addition of 5 µL of second strand synthesis mix (3 µL of elution buffer [Qiagen] ...
-
bioRxiv - Genomics 2023Quote: ... 1µM Template-Switching Oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” prefixes a ribonucleic acid base and “+” prefixes a locked nucleic acid base, Qiagen) then incubated using a ThermoMixer C with the following conditions ...
-
bioRxiv - Genetics 2021Quote: ... S2 cells were seeded at 1 × 106 cells/ml in a 6-well plate and transfected using Effectene (Qiagen, Germantown, MD). For mobility shift assay (Figure 4) ...
-
bioRxiv - Immunology 2023Quote: DNA was extracted from 1×10^6 CD4 Th cells/ replicate using the Qiagen DNA mini kit according to manufacturer’s instructions (Qiagen Hilden, Germany). DNA was extracted from 10ng of mouse brain tissue as previously described13 using NEB Monarch High molecular weight DNA extraction kit according to manufacturer’s instructions (NEB Cat #T3050).
-
bioRxiv - Developmental Biology 2023Quote: ... 200 ng psiCHECK-2 reporter plasmid were co-transfected with 5 µl miScript miRNA mimics (Qiagen; CatNo. 219600) using 4 µl Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... incubated at 65°C for 5 min and beaten for 5 min in a bead beater (Qiagen) set at high speed ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 6 µM and harvested 24 h later by adding RLT lysis buffer (Qiagen). Similarly ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue from 6 brains were pooled to prepare total RNA (RNEasy micro kit, Qiagen) for reverse transcription and amplification to cDNA (Ovation Pico WTA kit ...
-
bioRxiv - Immunology 2021Quote: ... and harvested for RNA extraction after 6 hours of incubation using RNAeasy kits (Qiagen). cDNA was synthesized from 500 ng of RNA using Quantitect Reverse Transcriptase kits (Qiagen) ...
-
bioRxiv - Genetics 2019Quote: HEK293Ts were plated in 6 well plates and transfected using Effectene Transfection Reagent (Qiagen) according the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... IL −6 and TNFα mRNA were detected by validated QuantiTect primer assays 144 (Qiagen).
-
bioRxiv - Biophysics 2023Quote: TSA measurements were carried out on a Rotor-Gene Q 6 plex (Qiagen, Germany) instrument at a heating rate of 2 °C/min and a temperature range of 25−90 °C in the presence of a CPM dye ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 nM siRNAs were mixed with 6 µl of HiPerFect transfection reagent (Qiagen, #301707) in 100 µl of serum free DMEM and added to freshly plated cells drop by drop ...
-
bioRxiv - Molecular Biology 2023Quote: Approximately 5 mg of frozen liver was homogenized in 1 ml RLT buffer (Qiagen) using a BeadBeater (BioSpec ...
-
bioRxiv - Cell Biology 2019Quote: ... 3-5 million cells were then harvested and genomic DNA was isolated using QIAamp DNA mini kit (QIAGEN, prod. number 51304). The following L1 recovery steps were adapted from24,52 with modifications ...
-
bioRxiv - Microbiology 2022Quote: ... and the amplified DNA bands from the 5’ and 3’ ends were individually excised and purified with QIAquick® Gel Extraction Kit (QIAGEN). Purified PCR products were cloned into pJET1.2/blunt plasmid (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... Cells were maintained at 37°C in 5% CO2 for 3 days before collecting genomic DNA using DNeasy Blood & Tissue Kits (Qiagen, 69504) and sequencing.
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNAs were prepared from livers of rats subjected to inhalational anesthesia with sevoflurane or desflurane for 6 hours or less than 1 minute using an RNeasy Midi Kit (QIAGEN, Venlo, Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...
-
bioRxiv - Bioengineering 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...