Labshake search
Citations for Qiagen :
701 - 750 of 1599 citations for 6 Chloro 4 methylamino pyridine 3 carboxylic acid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: For the functional validation of the miR-124/Zfp36l1 interaction a custom made miRCURY locked nucleic acid (LNA) miRNA Power Target Site Blocker (TSB) (Qiagen) was used with the following sequence ...
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Biophysics 2022Quote: ... Supernatants were incubated with glutathione Sepharose (GSH) fast flow beads (GE-Healthcare) for GST-tagged proteins or nickel– nitriloacetic acid (Ni-NTA) agarose (Qiagen) for His-tagged proteins for 2 h at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: Total viral RNA was extracted from deactivated samples using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (QIAGEN). One step reverse transcription to cDNA and real-time PCR (RT-PCR ...
-
bioRxiv - Developmental Biology 2019Quote: A locked nucleic acid (LNA) oligonucleotide probe antisense for the mature form of miR-92a-3p was designed and produced by Qiagen. The probe sequence was ACAGGCCGGGACAAGTGCAATA ...
-
bioRxiv - Plant Biology 2019Quote: ... Supernatant was applied twice to a column containing a gel bed of 2 ml nickel-nitriloacetic acid agarose (Qiagen, www.quiagen.com) equilibrated with lysis buffer ...
-
bioRxiv - Genomics 2021Quote: ... Nucleic acids were purified from the lysates using the Qiagen AllPrep DNA/RNA mini kit (Qiagen Inc., Valencia, CA, USA), quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Purification of p53-(1-73) from the clarified cell lysate was accomplished using a Nickel Nitrilotriacetic Acid (Ni-NTA, Qiagen) column purification and 50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: His-FlhAC and His-FlgN were purified by Ni affinity chromatography with a nickel-nitriloacetic acid (Ni-NTA) agarose column (QIAGEN) as described previously12 ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR reactions were performed using the miRCURY LNA SYBR Green PCR Kit and the following locked nucleic acid (LNA) SYBR green primers from Qiagen: mmu-miR-598-3p ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated by extraction with hot acid phenol essentially as described in (67) and purified using an RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... using Qiagen DNA Blood and Tissue Mini kit on a QIAcube automated nucleic acid extraction system following manufacture’s protocol (Qiagen, MD). The nine whole-genome resequencing samples were extracted from ear pinna by mincing the tissue and incubating it overnight in 200 ug/ml Proteinase K at 55 °C with gentle shaking ...
-
bioRxiv - Physiology 2021Quote: ... We infected Sf9 cells with the recombinant virus to express and purify the His-tagged proteins using a nickel-nitrilotriacetic acid (Ni-NTA, Qiagen) column ...
-
bioRxiv - Neuroscience 2021Quote: ... The frozen brain tissue blocks of WRM and BF were boiled for 8 min and homogenized in 5% acetic acid using a TissueLyser LT (Qiagen) for 6 min at 50 Hz ...
-
bioRxiv - Biochemistry 2021Quote: ... The soluble extracts were applied to 2-ml columns of nickel-nitrilotriacetic acid- agarose (Ni-NTA) (QIAGEN catalog no. 30210) that had been equilibrated with lysis buffer without protease inhibitors ...
-
bioRxiv - Immunology 2021Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Biophysics 2021Quote: ... Capture probes that contained locked nucleic acid (LNA) residues were purchased either from IDT with a 5′ Cy3 modification and HPLC purification or from Qiagen with a 5′ amino modification with HPLC purification ...
-
bioRxiv - Microbiology 2021Quote: ... as well as the relative amino acid content of SLPMh were calculated using the CLC Main Workbench 20.0.1 (QIAGEN, Aarhus, Denmark). Conserved domains in the amino acid sequence of SLPMh were identified based on hidden markov models via the HHPred server (Söding et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... which was done by hot acid phenol-chloroform treatment and further purified using RNeasy Mini Kit (Qiagen, Hilden, Germany, 74104). RNA stability was determined by agarose gel electrophoresis in 0.8% agarose Tris-Borato-EDTA (TBE ...
-
bioRxiv - Microbiology 2023Quote: ... viral nucleic acids were extracted using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH, QIAGEN Strasse 1, 40724 Hilden, Germany), which purifies RNA and DNA ...
-
bioRxiv - Microbiology 2023Quote: ... The cleared lysate was applied to an affinity chromatog-raphy column containing Ni-nitrilotriacetic acid (NTA) su-perflow resin (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The protein was purified under denaturing conditions by nickel-nitrilotriacetic acid (NTA)-agarose affinity chromatography as described by the manufacturer (Qiagen). A polyclonal rabbit antiserum was raised by Labcorp Early Development Laboratories Inc ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding the recombinant RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). On Day 0 ...
-
bioRxiv - Genomics 2023Quote: ... Samples were clarified by centrifugation at 2,000 rpm for 10 minutes and subjected to nucleic acid extraction using the cador Pathogen 96 QIAcube HT Kit (Qiagen) in a QIAcube HT automated extractor (Qiagen).
-
bioRxiv - Neuroscience 2023Quote: ... primary hippocampal neurons were transfected in duplicates or triplicates using 150ng of a plasmid carrying enhanced GFP-gene in combination with 5nmol Power Lock-Nucleic Acid inhibitors (Qiagen) against miR-218-5p ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient cell-free DNA was extracted from 1ml-1.2ml of patient plasma using the QIAamp Circulating Nucleic Acid Kit (QIAGEN # 55114) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Soluble protein was purified using immobilized-metal affinity chromatography (IMAC) by application of the cleared supernatant to nickel-nitrilotriacetic acid (NTA) beads (Qiagen) in a gravity flow column (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... equal amounts (200 µl) of FruK and Cra cell lysates were mixed with 100 µl of nickel-nitrilotriacetic acid beads (Qiagen). After overnight incubation at 4°C with gentle rotation ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant protein was partially purified by affinity chromatography on nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com). Purification steps were carried out as per the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... The soluble extracts were applied to 2 ml columns of nickel-nitrilotriacetic acid agarose (Ni-NTA) (QIAGEN catalogue no. 30210) that had been equilibrated with lysis buffer ...
-
bioRxiv - Genomics 2023Quote: Frozen pancreas tissue was homogenized using a motorized pestle prior to conducting nucleic acid extraction using the Qiagen AllPrep Universal kit (Qiagen). The processing of all samples was randomized to minimize batch effects attributed to age or sex ...
-
bioRxiv - Molecular Biology 2020Quote: ... After 14 h binding to 4 mL Ni-NTA agarose beads (Qiagen), the beads were first washed with 15 mL Ni-NTA binding buffer and then with 15 mL Ni-NTA wash buffer (1 M NaCl ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 µL of DNA) and run in Rotor-Gene Q machine (QIAGEN). Primer sequences are listed in the table S2 ...
-
bioRxiv - Bioengineering 2021Quote: ... Sample supernatants were incubated with 4 mL of Ni-NTA Agarose (Qiagen) for >1 hour at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... and pooled using the UltraClean 96 PCR Cleanup kit (Qiagen 12596-4) and Quant-iT dsDNA High Sensitivity Assay kit (Invitrogen Q33120) ...
-
bioRxiv - Microbiology 2022Quote: ... and pooled using the UltraClean 96 PCR Cleanup kit (Qiagen 12596-4) and Quant-iT dsDNA High Sensitivity Assay kit (Invitrogen Q33120) ...
-
bioRxiv - Genomics 2022Quote: ... and 4 µl of 100 mg/ml RNase A (QIAGEN, cat# 19101) were added to the homogenate ...
-
bioRxiv - Immunology 2022Quote: ... After diluting samples in a 4:1 ratio (elution buffer [Qiagen]:cDNA), cDNA concentration was determined using a Bioanalyzer (Agilent Technologies).
-
bioRxiv - Biochemistry 2020Quote: ... Crystallization screening was performed at 4°C with JCSG core I (Qiagen) using the sitting drop vapor diffusion method ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μl of DNA) and run in Rotor-Gene Q machine (Qiagen). Primer sequences are listed in the Table 2 ...
-
bioRxiv - Microbiology 2021Quote: ... Removed culture was mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen) for stabilization and incubated for 5 min at room temperature before centrifugation at 4000 rpm for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... with 4 × 108 copies of cel-miR-39 miRNA mimic (Qiagen 339390) spiked into to the sample after addition of lysis buffer.
-
bioRxiv - Molecular Biology 2022Quote: ... HL-1 cells were transduced with a pool of 4 gapmers (Qiagen) at 40nM (10Nm each ...
-
bioRxiv - Microbiology 2023Quote: ... The siRNAs were selected from the FlexiTube GeneSolution 4 siRNA sets (Qiagen) and transfected as a mix at 24 nM in Calu-3 and 10 nM in Caco-2 following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... At least 4 colonies were used for each DNA miniprep (QIAprep, Qiagen) and mutations were confirmed by Sanger sequencing (Source Bioscience) ...
-
bioRxiv - Neuroscience 2023Quote: ... at a frequency of 28/s @ 4°C (Tissue Lyser II, Qiagen). After this step the samples were adjusted to RT for 5 minutes and processed using the RNeasy Lipid Tissue Mini Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7.5 at 4°C) and purified using the RNAeasy kit (Qiagen).
-
bioRxiv - Microbiology 2020Quote: Whole genome amplifications were performed on DNA extracts at dilution 10 times through a multiple displacement amplification (MDA) step of 6 to 7 hours using the REPLI-g Midi Kit (QIAGEN) and following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... we extracted total RNA from CD4+/CD8+/CD3+ T cells (from spleen or bone marrow) of Foxp3-GFP or C57BL/6 mice using RNeasy Micro Kit (Qiagen) and cleaned from excess DNA with DNAse 1 enzyme (Promega) ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from blood (n=6 for each housing group) using the RNeasy Protect Animal Blood Kit (Qiagen) according to the manufacturer’s protocol ...