Labshake search
Citations for Qiagen :
601 - 650 of 2606 citations for 6 Bromo 3 4 dihydro 2H 1 benzopyran 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... RT buffer 5x (4 μL) RT primer mix and Reverse transcriptase (1 μL) (Qiagen, Cat. No. 205311) added in a final volume of 20 μL ...
-
bioRxiv - Biophysics 2023Quote: ... Nap1 FL was also labeled with XFD488 in 1:4 molar ratio after nickel affinity purification (Qiagen) and further purified with anion exchange and size exclusion chromatography (Cytiva) ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 μL of cDNA was added to 1 μL of pre-purchased primers (QuantiTect primers (Qiagen, Germany)) and qPCR was carried using the StepOnePlus machine (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tissues were weighed and homogenized in 4 volumes of water (4 µL of water/mg tissue, 4°C) using a bead beater (TissueLyser II, QIAGEN; Germantown, MD). Aqueous homogenates were profiled using four complimentary liquid chromatography tandem mass spectrometry (LC-MS ...
-
bioRxiv - Genomics 2022Quote: ... 400 nL of protease mix (6 μg protease (Qiagen, 19155), 6.25x NEBuffer 4 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 6 and 9 employing the RNeasy plant mini kit (Qiagen). RNA was quantified using Nanodrop (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... For MUS81 interference it was used FlexiTube HsMUS81 6 (Qiagen). SMARCAL1 was depleted using the MISSION esiRNA HUMAN SMARCAL1 (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2023Quote: ... 6 million PBMCs were lysed using QIAzol Lysis Reagent (Qiagen). Samples were stored at -80°C until RNA extraction ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 µg C19orf43 (purified from E. coli BL21 through Qiagen Ni-TA agarose using standard procedures ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 mL of Ni2+-NTA slurry (Qiagen, Venlo, LI, Netherlands) were equilibrated in a gravity flow column with Wash Buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... UniSpike 6 (included in the QIAGEN miRCURY LNA RT Kit) to verify the efficacy of reverse transcription (RT ...
-
bioRxiv - Neuroscience 2020Quote: ... containing Protease inhibitor cocktail (PIC, Complete, 1:25) and lysed at 4°C using a TissueLyser LT (Qiagen) on 50 Hz for 2 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... For SAS-6 knock down experiments siNegative control (siNegative, Qiagen, 1027310) and siSAS-6 (siSAS6 on-TARGET smart pool ...
-
bioRxiv - Plant Biology 2022Quote: ... 6 or 24 h using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA interference against MUS81 was performed using FlexiTube HsMUS81 6 (Qiagen) at final concentration of 10 nM using Lullaby 48 h before to perform experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Biophysics 2019Quote: ... Lysates were spun for a further 20 min at 40,000 g at 4 °C and resulting supernatants were incubated 1 hour with Ni2+-nitrilotriacetate (NTA) agarose beads (QIAGEN) at 4 °C on rotating wheel ...
-
bioRxiv - Microbiology 2019Quote: ... Cell lysates were then incubated at 4 °C for 1-1.5 hours on one ml of Ni-NTA resin (Qiagen). The resin was then loaded into columns (Biorad ...
-
bioRxiv - Physiology 2021Quote: ... 10-50 mg tissue was homogenized (1 mM EDTA and 4 mM sodiummetabisulfite, pH 7.4) using a TissueLyser II (Qiagen). Samples where adjusted to the same weight/volume percentage by adding a volume of homogenization buffer and the NA content was measured by ELISA (BA E-5200 ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 30 min at 45,000 × g at 4°C and incubated with 1 ml of Ni-NTA agarose beads (Qiagen) per 1 l of expression culture for 2 h rotating at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Lysates were clarified by centrifugation for 1 h at 4°C at 10,000 rcf before being subjected to Ni-NTA (Qiagen) affinity purification following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... The translation mixture was gently agitated in a microtube for 1 h at 4°C with a fivefold volume of Ni-NTA agarose (Qiagen) that had been equilibrated with a solution containing 50 mM Tris-HCl (pH 7.5 ...
-
bioRxiv - Genetics 2022Quote: ... The tissue powder was then transferred to a 1.5 mL centrifuge tube where 400 μL of 1% PVP-40 Buffer AP1 solution and 4 μL of RNase A were added (Qiagen DNeasy Plant Kit Qiagen Inc ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tumors were homogenized with QIAGEN Tissue Lyser (4 × 1’, 30 Hz) using a 5mm stainless steel bead (Qiagen, Hombrechtikon, Switzerland) and sonicated for 20s ...
-
bioRxiv - Microbiology 2019Quote: ... from the ME phase and ES phase (1 ml) were added to 4 ml and 2 ml of RNAprotect Bacteria Reagent (Qiagen), respectively ...
-
bioRxiv - Plant Biology 2020Quote: ... After vortexing the samples for 10 s and lysing the tissue with 4 mm glass beads for 1 min at 30 Hz in the TissueLyser II (Qiagen), 400 μL of Tris-HCl pH:7.5 were added and the samples were again mixed for 1 min in the TissueLyser ...
-
bioRxiv - Immunology 2020Quote: RNA was extracted from isolated neutrophils after the 1 and 4 hour EC challenges as well untreated controls using the miRNeasy Micro kit from Qiagen and libraries were generated using KAPA PolyA enrichment mRNA library prep ...
-
bioRxiv - Genomics 2021Quote: ... To eliminate lipids supernatants were applied to a RNeasy column and centrifuged at 10,000 rpm and 4 °C for 1 min (Qiagen, 74104). The flow through was collected and protein concentrations were assessed using the Bradford assay ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.4 mg/mL Proteinase K (55°C for 1 hour) before being purified using the QIAquick PCR purification kit (QIAGEN). qPCR was performed on the Rotor-Gene 3000 (Corbett Life Science ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting mixture was rotated at 4 °C for 60 min and then poured into a 1 mL polypropylene column (Qiagen). The resin was washed three times with 5 mL lysis/wash buffer and eluted in 0.25 mL fractions with Ni-NTA elution buffer (composition same as lysis/wash buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... previously coated with the anti-B55δ antibody (1 hour incubation at 4°C, followed by extensive washes) and Nickel beads (Qiagen) coated with 400 μg of 6XHIS-S67thio-S109A-XeARPP19 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The cell pellet was removed after centrifugation (16000 rpm, 4 °C, 1 h) and supernatant was loaded into a Ni-NTA agarose column (Qiagen). Protein was eluted in an elution buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... for 6 hours before RNA extraction using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Microbiology 2019Quote: ... using a MagAttract PowerMicrobiome DNA/RNA Kit (27500-4 EP/27500-4 EP-BP, Qiagen, Hilden, Germany). Amplicon library preparation and sequencing were done as described previously [35] ...
-
bioRxiv - Immunology 2020Quote: ... Pellets were lysed by vortexing for 1 minute in 350uL cold supplemented RLT buffer (RLT + β-MeOH) at 4°C and lysates homogenized using QIAshredder columns (Qiagen). RNA was then extracted from these samples using the RNeasy Plus Micro kit (Qiagen ...