Labshake search
Citations for Qiagen :
51 - 100 of 2464 citations for 6 Bromo 2 methylthiazolo 5 4 b pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... We extracted total RNA from 10 leaves that were shorter than 500 µm and from 4–6 mature leaves using the RNeasy Micro Kit (Qiagen) and the RNeasy Plant Mini Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was isolated from liver and lung tissues (n=4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Mini Kit (Qiagen) and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group ...
-
bioRxiv - Cancer Biology 2021Quote: ... and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Blood Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 250 to 1000 μm lengths of epithelium sections were microdissected from 4 to 6 successive serial sections and DNA extracted using a QIAMP DNA microkit (Qiagen) by digesting overnight and following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... diluted in fresh culture media or left untreated (n = 4) for 6 h prior to harvesting RNA in RLT buffer (Qiagen) with added β-ME ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Immunology 2019Quote: ... approximately 25 mg of tissues were homogenized in 2 mL tubes containing 600 μL of Buffer RLT with 2% β-mercaptoethanol and a stainless steel bead (5 mm, Qiagen) using a TissueLyser II system (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from frozen mouse liver (20-25 mg) and HepG2 cells (5-6 million) using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of bisDNA was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 2 μl of 10 μM primer mix (Methods Table 1) ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated for 2 h at 4 °C with Ni2+-NTA-agarose (Qiagen) (20 mg of proteins/ml of resin ...
-
bioRxiv - Immunology 2021Quote: ... Skin samples were homogenized in a TissueLyser LT (Qiagen, 50 Hz, 2 times 4 minutes) using 5 mm stainless steel beads (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... RAGE-/- and SOD1G93A x RAGE-/- mice (n = 5 - 6) using RNeasy Lipid Tissue extraction kit according to manufacturer’s instructions (QIAGEN, CA, USA). The total RNA was purified from genomic DNA contamination using Turbo DNase treatment (Ambion ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells in 6-well plates were transfected with 2 μg pIRES2-eGFP or Trim-HA-NUP153 derivatives using Effectene (Qiagen). At 24 h post-transfection ...
-
bioRxiv - Biochemistry 2022Quote: 3×106 cells from the day 8 of CD34+ HSPC and day 6 of HUDEP-2 erythroid differentiation were used for total RNA using RNeasy Mini Kit (Qiagen). For reverse transcription using Primescript RT reagent kit (Takara Bio Inc.) ...
-
bioRxiv - Genomics 2020Quote: ... and AH (20 weeks) old C57/Bl6/J mouse hearts (n= 4-6/group) using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from TG and NTG mice (n=4/group) at 6 months of age using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... collected into an Eppendorf tube and centrifuged at 11200 rpm at 4 °C for 6 min followed by pellet resuspension with 200 μl of QIAzol (Qiagen, Hilden, Germany). To isolate EC from the bottom layer ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was incubated for 2h at 4°C with 5 ml of Ni-NTA agarose (Qiagen) pre-equilibrated in wash buffer 1 WB1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131) overnight ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 (2×106 cells/well) using the RNeasy Mini Kit (Qiagen) with DNase I treatment to eliminate DNA contaminants as previously described18 ...
-
bioRxiv - Microbiology 2023Quote: Cellular RNA of 2-5×105 cells was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 mL cultures were immediately added to centrifuge tubes containing 4 mL RNAprotect Bacteria Reagent (Qiagen), vortexed for 5 seconds and incubated at room temperature for 5 min ...
-
bioRxiv - Genomics 2021Quote: cfDNA was extracted from 2-4 mL of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... rotated at 4°C for 1.5-2 hr in 0.75 mL equilibrated Ni-NTA Agarose (Qiagen), followed by packing pre-equilibrated Poly-Prep Chromatography Columns (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: DE genes between clusters 2 and 4 were fed to Ingenuity Pathway Analysis software from Qiagen. Enrichment pathways were sourced from Ingenuity core enrichment pathways.
-
bioRxiv - Genomics 2021Quote: ... or (B) a QIAquick PCR purification column (Qiagen) (proK-col) ...
-
bioRxiv - Cell Biology 2019Quote: ... Transient transfections were carried out using just subconfluent cultures in 35 mm plates or in wells of a 6-well plate using DNA in the range of 0.3-2 µg/culture and the Polyfect reagent (Qiagen, Germantown, MD) and the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Immunology 2023Quote: ... in vitro derived Foxp3+ cells were harvested on day 2 and day 6 into Trizol and total RNA was isolated with miRNeasy Micro Kits (QIAGEN 217084) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... The suspension was spun down at 16,000 r.c.f at 4 °C for 30 min and the supernatant was applied 5 ml Ni-NTA resin (Qiagen)/ L culture medium ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Plates were then placed at 4 0C before adding the reverse transcription mix containing 5’-biotinylated TSO (Qiagen). PCR products were cleaned up using 0.8:1 Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genetics 2019Quote: ... for lysis in 2 ml safe-lock tubes containing one 5 mm stainless steel bead (Qiagen) for 2.5-3 minutes at 30 Hz using TissueLyzer II (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 h time points were immediately mixed with 2 x volume of RNAProtect® (Qiagen) using the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNAs used were RAPH1 siRNA #2 (Hs_RAPH1_2, SI00698642) and RAPH1 siRNA #5 (Hs_RAPH1_5, SI04300982) provided by Qiagen.
-
bioRxiv - Cancer Biology 2023Quote: Each qPCR reaction consisted of 5 μL of 2× QuantiNOVA SYBR Green PCR master mix (Qiagen), 0.5 μL of 10 μM forward and reverse primers each ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Four 2-mL aliquots of culture were thoroughly mixed with 4 mL of RNAprotect Bacteria Reagent (Qiagen) and incubated at room temperature for 5 min before centrifugation at 4,000 × g for 12 min at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated for ~2 h rotating at 4°C with Ni-NTA Resin (Qiagen, 1018244) that had been washed with wash buffer (20mM Tris HCl pH 8.0 ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was extracted from 2 to 4 ml of plasma using the QIAsymphony liquid handling robot (Qiagen). cfDNA concentration was determined using Qubit double-strand molecular probes kit (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... The filtered supernatant was loaded onto 2 gravity columns each with 4 mL Ni-NTA agarose (Qiagen). The resin was pre-equilibrated with the lysis buffer ...
-
bioRxiv - Genetics 2024Quote: ... 2 or 4 days and genomic DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen). Bisulfite converted DNA libraries were prepared using the Accel-NGS Methyl-Seq DNA library kit (SWIFT BIOSCIENCES) ...
-
bioRxiv - Microbiology 2024Quote: Tissue samples of mice were transferred into 2 ml tubes containing 4 mm stainless steel beads (Qiagen) and 1 ml of ice-cold sterile saline ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA from 18 ONS cell samples (6 AD patients, 6 MCI and 6 HC) were extracted using Allprep universal kit (Qiagen cat. no. 80224). RNA-seq libraries were prepared using the Illumina TruSeq Stranded Total RNA library Prep Gold Kit (Illumina 20020598 ...
-
bioRxiv - Systems Biology 2020Quote: ... 6×10^6 PBMC from each sample were transferred directly to Quiazol regent (QIAGEN), resuspended and immediately aliquoted and stored at −80°C until RNAseq downstream processing ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... One million cells per well were seeded in 6 well plates in 2 mL growth medium the day before transfection and transfected with PolyFect (Qiagen, Düsseldorf, DE) using the manufacturers protocol (changing the medium to growth medium without hygromycin B and puromycin prior to transfection) ...
-
bioRxiv - Molecular Biology 2020Quote: 6 ml Ni-NTA (QIAGEN) was washed with 5 column volumes of wash buffer 1 (150 mM NaCl ...