Labshake search
Citations for Qiagen :
51 - 100 of 1985 citations for 6 Bromo 2 4 chlorophenyl quinoline 4 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: Tissue samples of mice were transferred into 2 ml tubes containing 4 mm stainless steel beads (Qiagen) and 1 ml of ice-cold sterile saline ...
-
bioRxiv - Genetics 2024Quote: ... 2 or 4 days and genomic DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen). Bisulfite converted DNA libraries were prepared using the Accel-NGS Methyl-Seq DNA library kit (SWIFT BIOSCIENCES) ...
-
bioRxiv - Genomics 2019Quote: ... cfDNA was extracted from 1 or 4 ml of urine according to manufacturer recommendations (Qiagen Circulating Nucleic Acid Kit, Qiagen, Valencia, CA) and quantified using a Qubit fluorometer 3.0 (high sensitivity double-stranded DNA kit ...
-
bioRxiv - Biochemistry 2020Quote: ... at 4°C and the supernatant was loaded onto a 1 ml nickel nitrilotriacetic acid-agarose column (Ni-NTA, Qiagen, Hilden, Germany) previously equilibrated with the corresponding lysis buffer ...
-
bioRxiv - Bioengineering 2024Quote: ... the extraction of total nucleic acid from transfected MOLT-4 cells (small scale, as described) was performed using a DNeasy Blood and Tissue Kit (QIAgen catalog # 69504) which includes direct lysis with proteinase K treatment ...
-
bioRxiv - Microbiology 2019Quote: ... using a MagAttract PowerMicrobiome DNA/RNA Kit (27500-4 EP/27500-4 EP-BP, Qiagen, Hilden, Germany). Amplicon library preparation and sequencing were done as described previously [35] ...
-
bioRxiv - Genomics 2020Quote: ... and AH (20 weeks) old C57/Bl6/J mouse hearts (n= 4-6/group) using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from TG and NTG mice (n=4/group) at 6 months of age using the RNeasy Mini Kit (Qiagen, Cat.74106) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... collected into an Eppendorf tube and centrifuged at 11200 rpm at 4 °C for 6 min followed by pellet resuspension with 200 μl of QIAzol (Qiagen, Hilden, Germany). To isolate EC from the bottom layer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl of diluted cDNA template was mixed with 4 μl QuantiTect SYBR Green PCR Master Mix (Qiagen), 100 nM forward primers (see Table 1 for sequences ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...
-
bioRxiv - Molecular Biology 2019Quote: ... with 4 µg RNAseA/ml (Qiagen 158922)] and placing cells on ice for 20 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 µg of RNaseA (Qiagen 28306) overnight as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 min, 4°C) prior to incubation (1 h, 4°C) with 4.0 mL of Ni-NTA agarose (Qiagen) pre-equilibrated in the same buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extract was cleared by centrifugation at 186,000g for 1 hour at 4 °C and then incubated at 4 °C with NiNTA resin (QIAGEN) for 4 h ...
-
bioRxiv - Neuroscience 2023Quote: ... Those included UniSpike 2 and 4 from the QIAGEN RNA Spike-In Kit (Cat. No.: 339390, QIAGEN, Hilden, Germany), which were used to monitor RNA isolation efficacy ...
-
bioRxiv - Cell Biology 2021Quote: ... of healthy (4 weeks of age) and hTNFtg mice (4 & 8 weeks of age) using the RNeasy mini or micro kit (QIAGEN), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: SUZ12 isogenic M3 MPNST cells were treated with or without DNMT inhibitors (50 nM daily Decitabine or 4 μM single dose of GSK862) for 4 days followed by genomic DNA isolation with Gentra Puregene cell kit (Qiagen). Bisulfite sequencing was conducted by the IGO core facility at MSKCC ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted from infected (n = 4) and control (n = 4) bAM samples using the RNeasy Plus Mini Kit (Qiagen) as previously described [91] ...
-
bioRxiv - Cell Biology 2023Quote: ... ULK2 (mixture of 4 siRNAs, GS9706), TBC1D14 (mixture of 4 siRNAs, GS57533) and non-targeting (NT, # 5091027310) were purchased from Qiagen.
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase Inhibitor (4 unit/µl) (cat # 1055213, Qiagen), rRNasin Rnase inhibitor (40 U/µl ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 4) DNeasy Plant Mini Kit (QIAGEN®) combined with the InhibitEx Buffer step from the QIAamp DNA Stool Mini Kit to improve inhibitor removal ...
-
bioRxiv - Microbiology 2019Quote: ... 4 µg/mL DNase I (QIAgen, Hilden, Germany), 2 µg/mL RNase A (QIAgen) ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of 100 mg/mL RNase (Qiagen) was added ...
-
bioRxiv - Immunology 2023Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen): cDNA ...
-
bioRxiv - Immunology 2021Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 200,000 g for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Microbiology 2021Quote: Total RNA of 1-2 x 106 human macrophages (2-4 biological replicates/ macrophage donors per condition, see Table S17) was isolated using RNeasy extraction kit (Qiagen) including DNAse treatment according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: A total of 600 μL (three × 200 μL) of day 4 SARS-CoV-2 culture supernatant was used as input into the RNeasy Mini Kit (Qiagen) for RNA extraction with minor modifications ...
-
bioRxiv - Cell Biology 2021Quote: Total mRNA was isolated from HEK293 (2×106) and Jurkat cells (4×106) parental and MCU-KO cell lines using the RNeasy Mini Kit (Qiagen). Isolated RNA was then analyzed using a NanoDrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA of 2 – 4 dpf zebrafish embryos was extracted using Trizol reagent and purified using the RNeasy Mini Kit (Qiagen), according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was isolated from approximately 100 EBs (differentiation day 2 and 3) or 25 EBs (differentiation day 4 and 5) using RNeasy Mini kit (Qiagen). 0.5 μg RNA was transcribed to cDNA using QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... from the ME phase and ES phase (1 ml) were added to 4 ml and 2 ml of RNAprotect Bacteria Reagent (Qiagen), respectively ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Lysates were clarified by centrifugation at 24,000gat 4 °C for 20 min and passed through 2 ml of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer ...
-
bioRxiv - Biochemistry 2019Quote: ... Cell lysate was separated by centrifugation at 28000 x g for 45 min and 4°C and the supernatant was loaded onto a column containing 2 mL of Ni-NTA agarose (Qiagen) equilibrated with buffer A for 1 h for purification by nickel affinity chromatography ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysates were clarified by centrifugation at 24,000g at 4°C for 20 min and passed through 2 mL of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... the cell lysate was cleared by centrifugation (20L000 rpm, 30 minutes, 4 °C) and purified using Ni+2-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Genetics 2024Quote: ... PCR was performed with 2 µL (∼16 ng) or 4 µL (∼32 ng) of BT-converted DNA with HotStar Taq Polymerase (Qiagen), depending on the genomic region ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was ground to small pieces by one steel ball (Ø 4 mm) in a 2 ml Eppendorf tube with Tissue Lyzer II (Qiagen, Hilden ...