Labshake search
Citations for Qiagen :
351 - 400 of 2711 citations for 6 Amino 5 chloro 2 cyclopropyl 4 pyrimidinecarboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Chondrocytes were transfected in duplo with antisense locked nucleic acid (LNA) GapmeR (Qiagen) targeting P3H2-AS1 (TGAGCAACTAGGTGTA ...
-
bioRxiv - Cell Biology 2021Quote: ... The soluble recombinant protein was purified using theNickel-Nitrilotriacetic acid (Ni-NTA+; Qiagen) resin ...
-
bioRxiv - Cancer Biology 2023Quote: ... all proteins were purified using Ni-NTA (nickel-nitrilotriacetic acid) resin from QIAGEN. After the incubation of Expi293 media supernatant with the Ni-NTA resin ...
-
bioRxiv - Cell Biology 2023Quote: ... The proteins were first purified using nickel-nitrilotriacetic acid (NTA) agarose resin (Qiagen), and the His8-SUMO tag was then removed by TEV protease (10:1 w/w ...
-
bioRxiv - Microbiology 2023Quote: ... viral nucleic acids were extracted using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with Ni-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germany) on a rocker for 1 hour at 4° C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... after which the chemokine was purified using nickel-nitrilotriacetic acid (NTA) resin (Qiagen). Purified CCL5 was refolded by first adding 4mM DTT to the eluate at pH>7 ...
-
bioRxiv - Microbiology 2023Quote: ... Bacterial nucleic acid was extracted using the EZ1 DNA tissue kit (Qiagen, Germany) on EZ1 Advanced XL (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: Locked nucleic acid (LNA) GapmeR ASOs were custom-designed and purchased from Qiagen, USA ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...
-
bioRxiv - Molecular Biology 2019Quote: ... with 4 µg RNAseA/ml (Qiagen 158922)] and placing cells on ice for 20 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 µg of RNaseA (Qiagen 28306) overnight as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested 6 h post-transfection and the extracted RNA (RNeasy, Qiagen) reverse transcribed to produce cDNA (QuantiTect ...
-
bioRxiv - Cell Biology 2020Quote: ... in the wells of 6 well plates (35mm) using Effectene transfection reagent(Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 6 and 9 hours of treatment using RNeasy Plus Mini Kit (Qiagen, 74134), and was reverse-transcribed to cDNA using Transcriptor First Strand cDNA Synthesis Kit with random primers (Roche ...
-
bioRxiv - Genetics 2019Quote: Raw sequence files (FASTQ) were imported into CLC Genomics Workbench (v.6; Qiagen) and mapped onto the human genome (GRCh37/hg19) ...
-
bioRxiv - Biophysics 2020Quote: ... The studies were carried out on a Rotor-Gene Q 6 plex (QIAGEN) instrument at a heating rate of 2 °C/min and a temperature range of 25-90 °C ...
-
bioRxiv - Molecular Biology 2022Quote: Two independent siRNAs targeting YBX1 (Hs_YBX1-1 and Hs_YBX1-6 FlexiTube siRNA, Qiagen) and a non-targeting negative control siRNA (AllStars ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from 6 dpf larvae (RNeasy Plus Mini Kit; Qiagen) and reversed transcribed (iScript Reverse Transcription Supermix ...
-
bioRxiv - Cancer Biology 2020Quote: ... and RPR2 (n=6) primary tumors was performed using RNeasy Mini Kit (Qiagen) with the standard protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The 6 PCR products were purified using the QIAquick PCR Purification Kit (Qiagen) to eliminate byproducts.
-
bioRxiv - Genetics 2023Quote: RNA was extracted from 6-well plates using miRNeasy Mini Kits (QIAGEN 217004) with the inclusion of an on-column DNase digestion (QIAGEN 79254) ...
-
bioRxiv - Microbiology 2021Quote: ... NG1 (5’ACCGACCACAGGGGG-3’) and NG2 (5’-GGTTGTAAACCTCTTTCGA-3’) and HotStarTaq® Master Mix Kit (Qiagen) up to a final volume of 25 μL ...
-
bioRxiv - Developmental Biology 2020Quote: ... and the soluble homogenates were purified by Ni-nitrilotriacetic acid (NI-NTA) Agarose (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acids were extracted from frozen faecal aliquots using the RNeasy PowerMicrobiome kit (Qiagen). The manufacturer’s protocol was modified by the addition of a heating step at 90°C for 10min after vortexing and by the exclusion of DNA-removal steps ...
-
bioRxiv - Microbiology 2019Quote: ... Nucleic acids were extracted using a Qiamp Viral Minelute spin kit (Qiagen, Hilden, Germany) according to the manufacturer’s directions.
-
bioRxiv - Systems Biology 2021Quote: ... The supernatant was loaded on a nickel nitrilotriacetic acid (Ni-NTA) resin (Qiagen GmbH) column ...
-
bioRxiv - Cell Biology 2021Quote: ... We purified the 6xHIS fusion protein on nickel-nitrilotriacetic acid agarose (Qiagen, Valencia, CA) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... Nucleic acids were extracted with the Qiagen Power Fecal Pro kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
Heterologous expression of Dehalobacter spp. respiratory reductive dehalogenases in Escherichia colibioRxiv - Microbiology 2021Quote: ... and nickel-nitrilotriacetic acid (Ni-NTA) agarose resin was purchased from Qiagen (Hilden, Germany). PCR reagents ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nucleic acids were subsequently extracted using the AllPrep DNA/RNA Mini Kit (QIAGEN, #80204) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... The enzyme was purified through a nickel-nitrilotriacetic acid column (Ni-NTA superflow, Qiagen), which was followed by a gel filtration column (Superdex 200 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 1.2 µM custom template-switching oligo with a Locked Nucleic Acid analog (Qiagen) at 42°C for 90 minutes ...
-
bioRxiv - Immunology 2020Quote: ... The His-tagged fusion peptide was purified using nickel–nitrilotriacetic acid (Ni–NTA, Qiagen) resin affinity chromatography and by C18 reverse-phase chromatography (Sep-Pak® Waters ...
-
bioRxiv - Microbiology 2022Quote: Total nucleic acids were extracted in duplicate using the PowerSoil-Kit (MO-BIO, Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... S1 RBD was purified from the culture supernatant by nickel–nitrilotriacetic acid agarose (Qiagen), and purity was confirmed to by >95% as judged by coomassie stained SDS-PAGE ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total ribonucleic acid (RNA) was extracted using the RNeasy mini kit (Qiagen, Hilden, Germany). RNA integrity and quantitation were assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged proteins were incubated with Nickel-nitrilotriacetic acid (NTA) sepharose (Qiagen, Hilden, Germany) at 4°C with slight shaking for 1 h ...
-
bioRxiv - Plant Biology 2020Quote: ... coli Rosetta cells was carried out using nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) as described in Barja and Rodríguez-Concepción (2020) ...
-
bioRxiv - Molecular Biology 2021Quote: ... we added 70 µl of Ni-NTA (Nickel Nitrilo-triacetic Acid) agarose beads (Qiagen), and incubated the mixture overnight at the orbital rotator at RT ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 ml of culture supernatant was incubated with nickel-nitrilotriacetic acid-agarose beads (QIAGEN). The beads were washed ...
-
bioRxiv - Molecular Biology 2023Quote: ... After purification of AtH2B.9 using nickel-nitrilotriacetic acid agarose (Ni-NTA) resin (QIAGEN), the His6-tag portion was removed by TEV protease (30 µg/mg of His6-H2B.9) ...
-
bioRxiv - Microbiology 2023Quote: Nucleic acid extraction was carried out using DNeasy PowerSoil Pro Kit (QIAGEN, Hilden, Germnay) following manufacturer instructions ...
-
bioRxiv - Biophysics 2022Quote: The obtained supernatant was incubated with Ni-nitrilotriacetic acid (Ni-NTA) resin (Qiagen, Germany) in a rotating shaker for 1 h ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The clarified lysate was incubated with nickel-nitrilotriacetic acid (Ni-NTA) agarose resin (Qiagen) for 1 hour with agitation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the clarified lysate was loaded on a Ni-nitrilotriacetic acid (NTA) agarose column (Qiagen) using the ÄKTA Explorer fast protein liquid chromatography system (FPLC ...