Labshake search
Citations for Qiagen :
201 - 250 of 2386 citations for 6 Amino 5 2 2 diethoxyethyl 4 hydroxy Pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from 4-6 dpf zebrafish larvae using the RNeasy Plus Micro Kit (Qiagen). cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Genomics 2021Quote: ... and Vero E6 cells infected with 2 patient virus isolates was converted to cDNA using reverse transcriptase from qiaseq SARS-CoV-2 primer pool (Qiagen kit, cat no. 333896). APOBEC3b (sense ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 30 mg of frozen tissue was placed into a 2 ml flat bottom centrifuge tube on dry ice with a 5 mm stainless steel bead (QIAGEN Germantown, MD, USA; Cat#69989) at the bottom ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 2 min at 40 Hz using TissueLyser LT (Qiagen). 500 µl PBS-tween (0.01% ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 μg of RNA was treated with Dnase I (Qiagen), copied to cDNA using an Oligo dT and the SuperScript™ II Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mL of nickel-charged resin (Qiagen, Ni-NTA Agarose) was added to a column (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... using the QIAstat-Dx Respiratory SARS-CoV-2 Panel (Qiagen). Viral stocks were produced infecting at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2022Quote: ... in a 2 mL cryovial using a tissue lyser (Qiagen) and 0.2mm ceramic beads ...
-
bioRxiv - Microbiology 2021Quote: ... or using the QIAseq SARS-CoV-2 Primer Panel (Qiagen) (for organoid supernatants) ...
-
bioRxiv - Cell Biology 2022Quote: ... with 1% 2-mercaptoethanol then passed through Qiashredder tubes (Qiagen). RNA was extracted using the RNeasy Isolation Kit (Qiagen ...
-
bioRxiv - Developmental Biology 2019Quote: ... slides were treated with 2 μg/ml Proteinase K (QIAGEN) for 5 minutes at room temperature ...
-
bioRxiv - Genomics 2021Quote: ... QIAseq SARS-CoV-2 Primer Panel (Qiagen, cat. no. 333895) and QIAseq FX DNA Library Kit were used in order to prepare amplicon libraries for viral genome sequencing ...
-
bioRxiv - Immunology 2020Quote: ... and extension by 2 × multiplex PCR master mix (QIAGEN, USA) at 72 °C for 30 s ...
-
bioRxiv - Microbiology 2022Quote: ... loaded with 1-2 ml Ni-NTA agarose resin (Qiagen) pre-equilibrated with binding buffer ...
-
bioRxiv - Genomics 2022Quote: ... and ‘Sy-2’ plants using Genomic Tip (Qiagen, Hilden, Germany), and high-molecular-weight DNA (fragment length > 40 kb ...
-
bioRxiv - Neuroscience 2022Quote: ... and IRS solution (Qiagen Cat No./ID: 26000-50-2) for a custom protocol ...
-
bioRxiv - Microbiology 2022Quote: ... for 2×2min at 30Hz in a TissueLyser II (Qiagen). After homogenization ...
-
bioRxiv - Biochemistry 2023Quote: ... then loaded on to 2 mL Ni-NTA column (Qiagen) pre-equilibrated with 10 column volumes of 50 mM Tris pH 7.5 containing 300 mM NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... coverslips were treated with 2 mg/ml RNase A (QIAGEN) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a 48-sample holder (Tissue Lyser 2, Qiagen). The samples were treated with 1 ml pre-cooled (-20°C ...
-
bioRxiv - Genomics 2023Quote: ... using a TissueLyzer II (QIAGEN, 2min, 25 Hz, 2 times). The samples were incubated at room temperature for 5min ...
-
bioRxiv - Developmental Biology 2023Quote: ... and RNU6-2 (Hs_RNU6-2_11 miScript Primer Assay, Qiagen, MS00033740) as housekeeping miRNA.
-
bioRxiv - Neuroscience 2023Quote: ... 2 μL of HiPerfect transfection reagent (cat. no. 301705, Qiagen) were mixed with 100 μL NeuroBasal medium without supplements ...
-
bioRxiv - Microbiology 2023Quote: ... fitted with a 2 ml tube holder (Qiagen, Germantown, MD). RNA was purified with the ZymoBIOMICS RNA Miniprep kit (R2001 ...
-
bioRxiv - Immunology 2023Quote: ... following a 2-step VDJ amplification using HotStarTaq Plus (Qiagen). PCR products were enzymatically cleaned again and illumina adapters and indexes were introduced via PCR ...
-
bioRxiv - Physiology 2024Quote: ... The supernatant was incubated with 2 mL Ni-NTA (Qiagen) for 1 hour at 4°C with gentle mixing ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Pellets were thawed in 2 mL RLT lysis buffer (Qiagen) containing 10 μL mL-1 of 2-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Effectene (4 μL of enhancer and 5 μL of Effectene reagent; Qiagen 301427) was used to transfect 500 ng of the indicated eGFP plasmid ...
-
bioRxiv - Systems Biology 2022Quote: ... RNA was isolated from 5-6 replicated lung slices from each treatment using miRNeasy Mini Kit (Qiagen) at time 0 and time 120 hours for all groups ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...