Labshake search
Citations for Qiagen :
451 - 500 of 2057 citations for 6 AMINOMETHYL INDOLE 1 CARBOXYLIC ACID TERT BUTYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Developmental Biology 2019Quote: A locked nucleic acid (LNA) oligonucleotide probe antisense for the mature form of miR-92a-3p was designed and produced by Qiagen. The probe sequence was ACAGGCCGGGACAAGTGCAATA ...
-
bioRxiv - Biochemistry 2019Quote: ... and the lysate was mixed gently with 4 ml (50% slurry) of nickel-nitrilotriacetic acid (Ni-NTA)-agarose resin (Qiagen) at 4°C for 1 h ...
-
bioRxiv - Plant Biology 2019Quote: ... Supernatant was applied twice to a column containing a gel bed of 2 ml nickel-nitriloacetic acid agarose (Qiagen, www.quiagen.com) equilibrated with lysis buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... we utilized 4 mL of plasma and cfDNA was isolated using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Hilden, Germany). The concentration of cfDNA was determined using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... Nucleic acids were purified from the lysates using the Qiagen AllPrep DNA/RNA mini kit (Qiagen Inc., Valencia, CA, USA), quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: His-FlhAC and His-FlgN were purified by Ni affinity chromatography with a nickel-nitriloacetic acid (Ni-NTA) agarose column (QIAGEN) as described previously12 ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR reactions were performed using the miRCURY LNA SYBR Green PCR Kit and the following locked nucleic acid (LNA) SYBR green primers from Qiagen: mmu-miR-598-3p ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated by extraction with hot acid phenol essentially as described in (67) and purified using an RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... using Qiagen DNA Blood and Tissue Mini kit on a QIAcube automated nucleic acid extraction system following manufacture’s protocol (Qiagen, MD). The nine whole-genome resequencing samples were extracted from ear pinna by mincing the tissue and incubating it overnight in 200 ug/ml Proteinase K at 55 °C with gentle shaking ...
-
bioRxiv - Physiology 2021Quote: ... We infected Sf9 cells with the recombinant virus to express and purify the His-tagged proteins using a nickel-nitrilotriacetic acid (Ni-NTA, Qiagen) column ...
-
bioRxiv - Neuroscience 2021Quote: ... The frozen brain tissue blocks of WRM and BF were boiled for 8 min and homogenized in 5% acetic acid using a TissueLyser LT (Qiagen) for 6 min at 50 Hz ...
-
bioRxiv - Biochemistry 2021Quote: ... The soluble extracts were applied to 2-ml columns of nickel-nitrilotriacetic acid- agarose (Ni-NTA) (QIAGEN catalog no. 30210) that had been equilibrated with lysis buffer without protease inhibitors ...
-
bioRxiv - Cell Biology 2021Quote: Formalin-fixed paraffin-embedded tissues were used for in situ hybridization (ISH) employing locked nucleic acid (LNA) probes labelled with digoxigenin (DIG) at both the 5′- and 3’-ends (Qiagen). ISH was performed with probes specific for miR-132-3p (10 nM ...
-
bioRxiv - Immunology 2021Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Biophysics 2021Quote: ... Capture probes that contained locked nucleic acid (LNA) residues were purchased either from IDT with a 5′ Cy3 modification and HPLC purification or from Qiagen with a 5′ amino modification with HPLC purification ...
-
bioRxiv - Microbiology 2021Quote: ... as well as the relative amino acid content of SLPMh were calculated using the CLC Main Workbench 20.0.1 (QIAGEN, Aarhus, Denmark). Conserved domains in the amino acid sequence of SLPMh were identified based on hidden markov models via the HHPred server (Söding et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... which was done by hot acid phenol-chloroform treatment and further purified using RNeasy Mini Kit (Qiagen, Hilden, Germany, 74104). RNA stability was determined by agarose gel electrophoresis in 0.8% agarose Tris-Borato-EDTA (TBE ...
-
bioRxiv - Biophysics 2020Quote: ... 45 min at 4 °C) and supernatant containing His-tagged proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) purification (Qiagen). Protein was eluted in a final elution buffer of 20 mM Tris pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: ... The cleared lysate was applied to an affinity chromatog-raphy column containing Ni-nitrilotriacetic acid (NTA) su-perflow resin (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The protein was purified under denaturing conditions by nickel-nitrilotriacetic acid (NTA)-agarose affinity chromatography as described by the manufacturer (Qiagen). A polyclonal rabbit antiserum was raised by Labcorp Early Development Laboratories Inc ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding the recombinant RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). On Day 0 ...
-
bioRxiv - Genomics 2023Quote: ... Samples were clarified by centrifugation at 2,000 rpm for 10 minutes and subjected to nucleic acid extraction using the cador Pathogen 96 QIAcube HT Kit (Qiagen) in a QIAcube HT automated extractor (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... equal amounts (200 µl) of FruK and Cra cell lysates were mixed with 100 µl of nickel-nitrilotriacetic acid beads (Qiagen). After overnight incubation at 4°C with gentle rotation ...
-
bioRxiv - Neuroscience 2023Quote: ... primary hippocampal neurons were transfected in duplicates or triplicates using 150ng of a plasmid carrying enhanced GFP-gene in combination with 5nmol Power Lock-Nucleic Acid inhibitors (Qiagen) against miR-218-5p ...
-
bioRxiv - Cancer Biology 2023Quote: ... Patient cell-free DNA was extracted from 1ml-1.2ml of patient plasma using the QIAamp Circulating Nucleic Acid Kit (QIAGEN # 55114) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Soluble protein was purified using immobilized-metal affinity chromatography (IMAC) by application of the cleared supernatant to nickel-nitrilotriacetic acid (NTA) beads (Qiagen) in a gravity flow column (Bio-Rad) ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant protein was partially purified by affinity chromatography on nickel-nitrilotriacetic acid (Ni-NTA) agarose beads (Qiagen, http://www.qiagen.com). Purification steps were carried out as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: Frozen pancreas tissue was homogenized using a motorized pestle prior to conducting nucleic acid extraction using the Qiagen AllPrep Universal kit (Qiagen). The processing of all samples was randomized to minimize batch effects attributed to age or sex ...
-
bioRxiv - Biophysics 2023Quote: ... The soluble extracts were applied to 2 ml columns of nickel-nitrilotriacetic acid agarose (Ni-NTA) (QIAGEN catalogue no. 30210) that had been equilibrated with lysis buffer ...
-
bioRxiv - Microbiology 2020Quote: Whole genome amplifications were performed on DNA extracts at dilution 10 times through a multiple displacement amplification (MDA) step of 6 to 7 hours using the REPLI-g Midi Kit (QIAGEN) and following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... we extracted total RNA from CD4+/CD8+/CD3+ T cells (from spleen or bone marrow) of Foxp3-GFP or C57BL/6 mice using RNeasy Micro Kit (Qiagen) and cleaned from excess DNA with DNAse 1 enzyme (Promega) ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from blood (n=6 for each housing group) using the RNeasy Protect Animal Blood Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... or trl RNA was was calculated using the 2-ΔΔCt method56 using RNA extracted from 500ul of cells following the 6 day incubation using an RNeasy Plus RNA extraction kit (Qiagen). Gene targets were amplified from cDNA using previously validated primers for clamp ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from frozen mouse liver (20-25 mg) and HepG2 cells (5-6 million) using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... was isolated from human PanNET specimens or cells grown on 6-cm or 10-cm plates using RNeasy mini kit (Qiagen) containing gDNA eliminator spin columns ...
-
bioRxiv - Genomics 2019Quote: ... Genomic DNA was extracted from 2 batches of 50 adult females from each condition (F0 GuyR, F0LD80, F2LD25 and F2LD75, see Fig. 6) using the PureGene kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... T cells (from pooled spleen and pLNs in Figure 4 or from mLN in Supplementary Figure 6) from Foxp3Cre WT mice and Tet2/3fl/flFoxp3Cre DKO mice (14-weeks old) using RNeasy plus mini kit (Qiagen). RNA-sequencing libraries were prepared using Truseq stranded mRNA kit (Illumina ...
-
bioRxiv - Biochemistry 2020Quote: ... 5.6 x 105 cells were seeded in 4 ml DMEM in a 6-cm culture plate and transfected with targeting or control siRNA (Table 4) (from Qiagen) to a final concentration of 20 nM for each siRNA used ...
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... Transcripts were stabilized by mixing 3 mL of cell cultures at the mid-log phase with 6 mL of RNAprotect Bacteria Reagent (Qiagen). Samples were immediately vortexed for 5 sec ...
-
bioRxiv - Neuroscience 2021Quote: ... SH-SY5Y cells were treated either with 100 μM cycloheximide (CHX) or DMSO for 6 hours (41) before harvesting the RNA through RNeasy Minikit (Qiagen). Reverse transcription was performed using RevertAid cDNA synthesis kit (Thermo) ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted by quantitative RT-PCR from Col-0 and DWF4-OE seedlings 6 days post germination with the RNeasy Mini Kit (Qiagen). For DWF-OE ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated from cells (6-well dishes) or liver pieces (∼10-15mg) using the RNeasy Plus Mini kit (Qiagen). For livers ...
-
bioRxiv - Immunology 2022Quote: BMDMs cells treated in 6-well plate where washed twice with PBS before total RNA purification using the RNeasy kit (Qiagen) following manufacturer’s recommendations and quantified on a nanodrop 2000 (Thermo Fisher) ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μl of blood from K2-EDTA collection tubes was collected prior to centrifugation and was added to 600 μl of AVL viral lysis buffer with 6 μL carrier RNA (Qiagen) for RNA extraction ...
-
bioRxiv - Cell Biology 2022Quote: HCEC-B4G12 (n = 9) and F35T (n = 6) cells were pelleted and RNA was extracted and purified using RNeasy kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from the leaves of 4-to-6-week old plants using the RNeasy Plant Mini Kit (Qiagen). RNA concentrations were quantified using a Qubit RNA BR Assay Kit (ThermoFisher ...
-
bioRxiv - Plant Biology 2021Quote: ... We extracted total RNA from 10 leaves that were shorter than 500 µm and from 4–6 mature leaves using the RNeasy Micro Kit (Qiagen) and the RNeasy Plant Mini Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA was isolated from control and DAC treated U2OS cells growing on the 6-well plates using miRNAeasy kit (Qiagen) according to the manufacturer’s protocol and eluted in 50 μL RNAse-free water ...
-
bioRxiv - Molecular Biology 2019Quote: Genomic DNA was isolated from control and DAC treated U2OS cells growing on the 6-well plates using QIAamp DNA Mini Kit (Qiagen), and bisulfite-converted using MethylEdge™ Bisulfite Conversion System (Promega ...