Labshake search
Citations for Qiagen :
301 - 350 of 3611 citations for 6 4 METHOXY PHENYL 2 PHENYL PYRAZOLO 1 5 A PYRIMIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Biophysics 2019Quote: ... Lysates were spun for a further 20 min at 40,000 g at 4 °C and resulting supernatants were incubated 1 hour with Ni2+-nitrilotriacetate (NTA) agarose beads (QIAGEN) at 4 °C on rotating wheel ...
-
bioRxiv - Microbiology 2019Quote: ... Cell lysates were then incubated at 4 °C for 1-1.5 hours on one ml of Ni-NTA resin (Qiagen). The resin was then loaded into columns (Biorad ...
-
bioRxiv - Physiology 2021Quote: ... 10-50 mg tissue was homogenized (1 mM EDTA and 4 mM sodiummetabisulfite, pH 7.4) using a TissueLyser II (Qiagen). Samples where adjusted to the same weight/volume percentage by adding a volume of homogenization buffer and the NA content was measured by ELISA (BA E-5200 ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 30 min at 45,000 × g at 4°C and incubated with 1 ml of Ni-NTA agarose beads (Qiagen) per 1 l of expression culture for 2 h rotating at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Lysates were clarified by centrifugation for 1 h at 4°C at 10,000 rcf before being subjected to Ni-NTA (Qiagen) affinity purification following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Cell Biology 2021Quote: ... 5×10^5 EpCAM+ve cells were lysed in 350μL RTL Buffer (Qiagen) containing 143mM β-Mercaptoethanol (aided by cell searing via passage ...
-
bioRxiv - Microbiology 2021Quote: ... prior to the addition of proteinase K and 5 μl of 100 mg ml−1 RNase A (Qiagen). The DNA concentration was determined using a Qubit fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: Whole RNA was extracted from over 1 × 10^5 cells using the QIAGEN RNeasy Micro kit (QIAGEN, 74004) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μl diluted cDNA (1:20) were added to SYBR Green PCR Master Mix (Qiagen, Hilden, Germany) and 10 μM of both forward and reverse primer (Primer Sequences Table 1) ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were homogenized for 2 × 1 min at 30 Hz using a TissueLyser (Qiagen, Hilden, Germany) and stored at -20 °C until further processing.
-
bioRxiv - Molecular Biology 2022Quote: ... and 1-2 µg of RNA was used for the cDNA synthesis (Omniscript RT Kit (Qiagen, 205111)) ...
-
bioRxiv - Immunology 2020Quote: ... in purity mode into 96-well microplates containing 10 μL of 1% 2-mercaptoethanol RLT buffer (Qiagen) and stored at −80°C ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA was isolated from 1-2 mm tail tissue using the DNeasy Blood and Tissue Kit (Qiagen) following the protocol for isolation of DNA from animal tissues and was eluted in 100 µl H2O ...
-
bioRxiv - Cell Biology 2020Quote: ... The siRNA oligonucleotides targeting Arf1 and IRSp53 were purchased from Qiagen (Flex-iTube GeneSolution GS375 for Arf1; siArf1#1 Cat. No. SI02654470; siArf1#2 Cat. No. SI00299250; Qiagen Flex-iTube IRSp53 siRNA#1 Cat ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were homogenized (2 x 1 min at 30 Hz) by a TissueLyser (Qiagen, Hilden, Germany) and stored at -20 °C until next step ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mL of culture (0′) was removed and mixed with 2 mL of RNAprotect Bacterial Reagent (QIAGEN), vortexed ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Plant Biology 2021Quote: ... The translation mixture was gently agitated in a microtube for 1 h at 4°C with a fivefold volume of Ni-NTA agarose (Qiagen) that had been equilibrated with a solution containing 50 mM Tris-HCl (pH 7.5 ...
-
bioRxiv - Genetics 2022Quote: ... The tissue powder was then transferred to a 1.5 mL centrifuge tube where 400 μL of 1% PVP-40 Buffer AP1 solution and 4 μL of RNase A were added (Qiagen DNeasy Plant Kit Qiagen Inc ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tumors were homogenized with QIAGEN Tissue Lyser (4 × 1’, 30 Hz) using a 5mm stainless steel bead (Qiagen, Hombrechtikon, Switzerland) and sonicated for 20s ...
-
bioRxiv - Plant Biology 2020Quote: ... After vortexing the samples for 10 s and lysing the tissue with 4 mm glass beads for 1 min at 30 Hz in the TissueLyser II (Qiagen), 400 μL of Tris-HCl pH:7.5 were added and the samples were again mixed for 1 min in the TissueLyser ...
-
bioRxiv - Immunology 2020Quote: RNA was extracted from isolated neutrophils after the 1 and 4 hour EC challenges as well untreated controls using the miRNeasy Micro kit from Qiagen and libraries were generated using KAPA PolyA enrichment mRNA library prep ...
-
bioRxiv - Genomics 2021Quote: ... To eliminate lipids supernatants were applied to a RNeasy column and centrifuged at 10,000 rpm and 4 °C for 1 min (Qiagen, 74104). The flow through was collected and protein concentrations were assessed using the Bradford assay ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.4 mg/mL Proteinase K (55°C for 1 hour) before being purified using the QIAquick PCR purification kit (QIAGEN). qPCR was performed on the Rotor-Gene 3000 (Corbett Life Science ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting mixture was rotated at 4 °C for 60 min and then poured into a 1 mL polypropylene column (Qiagen). The resin was washed three times with 5 mL lysis/wash buffer and eluted in 0.25 mL fractions with Ni-NTA elution buffer (composition same as lysis/wash buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... previously coated with the anti-B55δ antibody (1 hour incubation at 4°C, followed by extensive washes) and Nickel beads (Qiagen) coated with 400 μg of 6XHIS-S67thio-S109A-XeARPP19 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The cell pellet was removed after centrifugation (16000 rpm, 4 °C, 1 h) and supernatant was loaded into a Ni-NTA agarose column (Qiagen). Protein was eluted in an elution buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... for 6 hours before RNA extraction using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4C (Qiagen, SI05163977), and 20 nM HIF1A Flexitube GeneSolution siRNA (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4B (Qiagen, SI00449764), 5 nM siKDM4C (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Genetics 2021Quote: ... 5 mM Multiplex-Kit (Qiagen) and HPLC water to a total volume of 10 μL per sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 uL EB buffer (QIAGEN) was added to each well and mixed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 μl RLT (79216, Qiagen) was added ...
-
bioRxiv - Microbiology 2019Quote: ... using a MagAttract PowerMicrobiome DNA/RNA Kit (27500-4 EP/27500-4 EP-BP, Qiagen, Hilden, Germany). Amplicon library preparation and sequencing were done as described previously [35] ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA from 1-5 million total CD4+ T cells was isolated using the Gentra Puregene Cell Kit (Qiagen) or phenol-chloroform and the DNA concentration was measured by Qubit High Sensitivity Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: The LRH-1-10CA-TIF2 complex was concentrated to 5 mg/mL and screened using the Classics screen (Qiagen) and a Phoenix Liquid Handler (Art Robbins Instruments ...
-
bioRxiv - Immunology 2023Quote: ... 14-666-315) containing 1 mL sterile PBS and one 5 mm stainless steel bead (QIAGEN Cat. No. 69989). Nucleic acids were isolated from excised granulomas by homogenizing in TRIzol (Invitrogen ...