Labshake search
Citations for Qiagen :
351 - 400 of 2894 citations for 6 1 BROMO ETHYL 4 CHLORO 5 FLUOROPYRIMIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... 5-10 μg RNA was DNAse treated (Qiagen) and rRNA was depleted (MICROBExpress ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 mm diameter stainless steel beads (QIAGEN) were added to each sample pool ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... and 5-mm stainless-steel beads (Qiagen #69989) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL Proteinase K (20 mg/mL, Qiagen) and 100 µl 10% SDS (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... in 5-ml polypropylene columns (no. 34964; Qiagen), washed with 50 mM Na2HCO3 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and 5-mm stainless steel beads (Qiagen #69989). RNA purification was performed using the NucleoSpin RNA kit (Macherey-Nagel ...
-
bioRxiv - Microbiology 2021Quote: ... in a 5 ml tube (Qiagen, DNAse/RNAsefree). The sediment samples were kept at 4 °C until the next day and then stored at −80 °C ...
-
bioRxiv - Immunology 2020Quote: ... 5×106 PBMCs were resuspended in RLT (Qiagen) and incubated at room temperature for 10 min prior to storage at –80°C ...
-
bioRxiv - Physiology 2020Quote: ... with 5 mm beads in RLT buffer (Qiagen) containing 1% β-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... + 5% beta-mercaptoethanol using a bead mill (Qiagen). Samples were heated at 95° for 5 minutes to denature proteins ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Microbiology 2022Quote: ... containing 5 mm diameter stainless steel beads (Qiagen) and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of 2U/μL Turbo DNase (Qiagen), and 1 μL of 10 mg/mL RNase A (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM primers and 1 μl DNA template ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM Primer and 1 μl DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl Polyfect Transfection Reagent (Qiagen, catalog # 301105) was added ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 mm stainless steel beads (Qiagen, #69989). Lysates were incubated for 2 h at 37°C protected from light ...
-
bioRxiv - Molecular Biology 2019Quote: ... 6 and 24 hpi cells were harvested into an appropriate volume of QIAzol lysis reagent (Qiagen) and RNA prepared using the miRNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2019Quote: ... and 6 week old Csf1fl/fl and NesCreCsf1fl/fl mice using a miRNeasy Micro Kit (Qiagen), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... for 6 hours and then harvested using buffer RLT from the RNeasy mini kit (Qiagen 74104).
-
bioRxiv - Microbiology 2022Quote: ... 3 mL samples were added to tubes containing 6 mL RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and vortexed ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted from 6-day-old gemmalings using the RNeasy Plant Mini Kit (QIAGEN) or NucleoSpin RNA Plant (Macherey-Nagel) ...
-
bioRxiv - Microbiology 2022Quote: 1.5×105 Acanthamoeba castellanii cells were transfected with 6 μg of linearized plasmid using Polyfect (QIAGEN) in phosphate saline buffer (PBS) ...
-
bioRxiv - Microbiology 2022Quote: 1.5×105 Acanthamoeba castellanii cells were transfected with 6 μg of each plasmid using Polyfect (QIAGEN) in phosphate saline buffer (PBS) ...
-
bioRxiv - Genetics 2023Quote: ... and 6 were performed to extract RNA using the RNeasy Plus Universal Kit (Qiagen, Hilden, Germany) and protein using an SMA enzyme-linked immunosorbent assay (ELISA ...
-
bioRxiv - Immunology 2023Quote: ... Transfection of siRNA was performed overnight using 6 nM for each siRNA with HiPerFect reagent (QIAGEN) according to the manufacturer’s reverse transfection protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Bulk tumor-bearing tissues were homogenized in 6 ml of cell lysis buffer (Puregene, 158063, Qiagen) using a FastPrep-24 5G tissue homogenizer (116005500 ...
-
bioRxiv - Biochemistry 2024Quote: ... Proteins modified with 6×-His-Ub was purified using Ni-NTA Sepharose (142350243, Qiagen, Alameda, CA) on a rotating platform for 2 hours at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... placed into a 2 mL tube with 600 μL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989), then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Genomics 2019Quote: ... are prepared as follows: 4 µL of Vapor-Lock (Qiagen) is manually added to each well using a multichannel pipette followed by 2 µL of lysis buffer (0.2 µL of 25 µg/µL Qiagen Protease ...
-
bioRxiv - Pathology 2021Quote: ... RNA was extracted using RNeasy Mini Kit (Qiagen 741-4) per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... and WNT signaling targets PCR array (Qiagen, PAMM 243ZE-4) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... and incubated with 4 mg/mL RNase A (Qiagen 158922) diluted 1:286 in 2X SSC for 30 min at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs were selected among FlexiTube GeneSolution 4 siRNA sets (Qiagen) and reordered after validation as dTdT-overhanging 19 nt RNA duplexes (Thermo) ...
-
bioRxiv - Microbiology 2020Quote: ... 4) Powersoil® Isolation kit (MO Bio Laboratories/Qiagen, Canada) by the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subsequently normalized to 4 nM using elution buffer (Qiagen) with 0.1% Tween20 (Sigma) ...
-
bioRxiv - Developmental Biology 2019Quote: RNA was extracted from pools of 6 × 105 FACS-isolated cells using the miRNeasy Micro Kit (Qiagen). Quantification of total RNA was performed by Qubit® RNA BR Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were transfected in 10 cm2 or 6-well plates at ∼60% confluency using PolyFect (Qiagen 301107) and washed with complete media 6 h later.
-
bioRxiv - Plant Biology 2020Quote: ... Total RNA (at least 6 μg) was extracted using the RNeasy Plant Mini kit (Qiagen, Hilden, Germany), with an additional step to remove contaminating DNA ...
-
bioRxiv - Plant Biology 2020Quote: ... 6 and 48 HAT to ammonium or nitrate amended plates using RNeasy® Plant Mini kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: SH-SY5Y cells plated in 6-well plates were lysed using 750ul of QIAzol Lysis reagent (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... GAS and SOL muscles from 6 mice per group were pulverized and lysed in RLT buffer (Qiagen) and treated with proteinase K (Qiagen ...