Labshake search
Citations for Qiagen :
451 - 500 of 2904 citations for 6 1 Aminoethyl 2H 1 4 benzoxazin 3 4H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... 5nmol of Rho-1 siRNA (Qiagen, Germany #SI01401743) was diluted in rnase-free water (provided in kit ...
-
bioRxiv - Biochemistry 2021Quote: ... passed over 1 mL Ni-NTA resin (Qiagen), and bound protein eluted with 10 CV of buffer A / 200 mM imidazole ...
-
bioRxiv - Genetics 2019Quote: ... 1× Type-it Multiplex PCR Master Mix (Qiagen), 0.2 μM of each locus specific reverse primers ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen, Hilden, Germany), and 0.2 μM of Primer_F3 and Primer_R (Figure S2 and Table S2) ...
-
bioRxiv - Genomics 2022Quote: ... 1 mL of buffer PB or PM (Qiagen), containing a high concentration of guanidine hydrochloride and isopropanol was added and mixed by pipetting ...
-
bioRxiv - Physiology 2022Quote: ... Samples were homogenized in 1 ml Qiazol (Qiagen) with 5 μl β-mercaptoethanol using a beadmill homogenizer cooled with liquid nitrogen and then phase separated using 1-bromo-3-chloropropane (BCP) ...
-
bioRxiv - Biophysics 2023Quote: ... Approximately 1 ml of Ni-NTA agarose (Qiagen) was utilised for purification of the lysate resulting from 1 l culture ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mL of RNA protect reagent (76506, Qiagen) was added to 500 µL of the sample ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 mL of ice-cold Qiazol (Qiagen, 79306) reagent was added and transferred into Precellys® lysing kit tubes (Keramik-kit 1.4/2.8 mm ...
-
bioRxiv - Immunology 2023Quote: ... Samples were diluted 9:1 (elution buffer (Qiagen):cDNA ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1% Protease Inhibitor using TissueLyser II (Qiagen) and 5 mm stainless steel beads (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteinase K (20 μg·ml-1 final concentration, Qiagen) was firstly added to the relevant samples ...
-
bioRxiv - Biochemistry 2024Quote: ... and anti-Strep (Qiagen, 34850, 1:1000 dilution) antibodies ...
-
bioRxiv - Molecular Biology 2021Quote: Ni-NTA agarose beads (Qiagen 70666-3)
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... For SAS-6 knock down experiments siNegative control (siNegative, Qiagen, 1027310) and siSAS-6 (siSAS6 on-TARGET smart pool ...
-
bioRxiv - Plant Biology 2022Quote: ... 6 or 24 h using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA interference against MUS81 was performed using FlexiTube HsMUS81 6 (Qiagen) at final concentration of 10 nM using Lullaby 48 h before to perform experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
rpoB, a promising marker for analyzing the diversity of bacterial communities by amplicon sequencingbioRxiv - Microbiology 2019Quote: ... and were subjected to three cycles of grinding (1 minute, at 30 Hz followed by 1 minute without agitation) in a TissueLyser II apparatus (Qiagen, France). The solutions obtained from crushed nematodes or the contents of G ...
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted with 1 volume of 25:24:1 phenol-chloroform-isoamyl alcohol and purified with QIAquick PCR Purification Kit (QIAGEN 28104). Libraries were prepared with the Ovation Ultralow V2 DNA-Seq Library Preparation Kit (NuGEN (Redwood City ...
-
bioRxiv - Immunology 2023Quote: ... 120 mg l− 1 sodium pyruvate and 1% penicillin–streptomycin) at 300 Hz for 2 minutes using a TissueLyser II (Qiagen, Germany).
-
bioRxiv - Biochemistry 2023Quote: ... the membrane was incubated for 1 hour with monoclonal α-His antibodies conjugated to the horseradish peroxidase (1:5000 dilution; Qiagen). Blots were visualized with the addition of Lumina Forte Western HRP Substrate (MilliporeSigma ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... 10μL volume PCR assays were conducted using Quantifast One Step RT-PCR kit (Qiagen, UK) on a ViiA7™ Real-Time PCR System (Applied bio-systems ...
-
bioRxiv - Microbiology 2020Quote: ... Seven overlapping RT-PCR fragments were generated with the One-Step RT-PCR Kit (Qiagen) and purified using the Zymoclean Large Fragment DNA Recovery kit (Zymo Research) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified by one-step qRT-PCR using QuantiFast Probe PCR reagents (Qiagen) and primers and probes specific for the SARS-CoV2 sub-genomic E RNA as previously described (Corman et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and analysed using a one-step RT-PCR (PCR with reverse transcription) kit from Qiagen, both using the standard protocol ...
-
bioRxiv - Developmental Biology 2022Quote: RNA from one million cells was isolated using the RNeasy plus mini kit (Qiagen #74134). 5μg of RNA was subjected to ribosomal and mitochondrial RNA depletion using the RiboZero Gold kit (Human/Mouse/Rat ...
-
bioRxiv - Microbiology 2022Quote: ... One-step RT-qPCR was performed with QuantiFast Probe RT-PCR+ROX Vial Kit (Qiagen) on the Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Cell Biology 2023Quote: ... One μg total RNA was used for cDNA synthesis using Quantinova Reverse Transcription kit (Qiagen). Real time PCR was performed in an ABI Prism 7500 (Applied Biosystems ...
-
bioRxiv - Genomics 2023Quote: ... Gel-based RT-PCR analyses were performed using the One-Step RT-PCR kit (Qiagen) in a final volume of 10 µL starting from 0.03 µg of DNase- treated (RQ1 Rnase-free Dnase supplemented with Rnasin Ribonuclease Inhibitor ...
-
bioRxiv - Neuroscience 2024Quote: ... CeA tissue was prepared for homogenization by placing one stainless steel bead (5mm) (Qiagen, PN69989) inside the tube ...
-
bioRxiv - Microbiology 2024Quote: ... run using the QIAcuity One Digital PCR System (Qiagen, 2-plex Device, Cat. No. 911001). The following conditions were used for the one-step cycling dPCR program ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...