Labshake search
Citations for Qiagen :
451 - 500 of 3411 citations for 6' CHLORO 2' 3' DIHYDRO 1'H SPIRO CYCLOPROPANE 1 4' ISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... purified nucleic acids were treated with 1-5 μl 1 mg/ml RNaseA (Qiagen) for 45 minutes at 37 °C to degrade RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 30 uL/well 1 X lysis buffer (1x Qiagen TCL, 1% beta-mercaptoethanol) was added ...
-
bioRxiv - Biophysics 2022Quote: ... The YB-1 (1-180) protein fragment was purified following the manufacturer’s recommendations (Qiagen). Briefly ...
-
bioRxiv - Biophysics 2022Quote: ... supernatant was combined with Ni-NTA resin (1 mL/1 L of biomass, Qiagen) pre-equilibrated with 20 mM HEPES ...
-
bioRxiv - Genomics 2023Quote: ... slides were treated with 1 mg/ml RNase A (1 mg/ml, Qiagen, 19101) in 2x SSC for at least 45 min at 37°C and then dehydrated in a 70% ...
-
bioRxiv - Cell Biology 2023Quote: ... snap frozen samples were homogenized in an Eppendorf tube using a 3-mm Tungsten carbide beads and TissueLyser II system (Qiagen; 4 min at 30 Hz). RNA isolation steps were followed as mentioned above in this section ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1× QuantiNova RT Mix (Qiagen), 1× QuantiNova SYBR Green RT-PCR Master mix ...
-
bioRxiv - Microbiology 2021Quote: ... Strep 1:1000 (Qiagen, 34850).
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μM oligo-dT18 (Qiagen) and 10 μM random hexamers (Promega).
-
bioRxiv - Epidemiology 2019Quote: ... version 1 (Qiagen, Hilden, Germany) with the automated instrument QIAsimphony (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... 1% SDS (Qiagen P2 buffer). Neutralize lysis buffer by adding 300 μL of 4.2 M Guanidine HCl ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μl of DNase (Qiagen) was added ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ml of QIAzol (Qiagen) was added to each pellet suspension before being transferred to Lysing Matrix B tubes (MP Biomedicals) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 U Hotstar Taq (Qiagen), 1X Hotstar Taq buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% SDS (Qiagen P2 buffer). Neutralize lysis buffer by adding 300 μL of 4.2 M Guanidine HCl ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μM TSO (Qiagen). The master mix was dispensed using the MANTIS liquid dispenser followed by mixing for 1 min at 1800 rpm on a plate shaker (Biosan) ...
-
bioRxiv - Genetics 2019Quote: ... cfDNA was extracted from 2 mL of plasma at baseline and from 3 mL of plasma post-treatment using QIAamp DNA purification kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from peripheral blood leukocyte samples from visit 2 or 3 using the Gentra Puregene Blood Kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions (www.qiagen.com ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... placed into a 2 mL tube with 600 μL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989), then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... 27620, 1:2,000 dilution) (rabbit anti-Spike S1, Cell Signaling, Cat #: 99423, 1:2,000 dilution) (mouse anti-Strep, Qiagen, Cat #: 34850, 1:2,000 dilution) (rabbit anti-ORF8 ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from both initial mixtures (0 h incubation) and end point co-cultures (72 h incubation) using the DNeasy Power Biofilm extraction kit (DNeasy PowerBiofilm, Qiagen, Mississauga, ON) as described previously [5] ...
-
bioRxiv - Cell Biology 2019Quote: ... KIF4A siRNA 5’-CAGGTCCAGACTACTACTC-3’ against the 3’-UTR was obtained from QIAgen, and an optimised siRNA pool for KIF22 (KID ...
-
bioRxiv - Physiology 2020Quote: ... Erythrocytes were lysed for 3 minutes with 3 ml of EL buffer (Qiagen). After Fc blocking for 20 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3’mRNA-seq libraries were prepared using QIAseq UPX 3’ Transcriptome Kit (QIAGEN). In brief ...
-
bioRxiv - Microbiology 2023Quote: ... The SCGs cultured in 6-well dishes and one entire 6-well was harvested and pooled together for RNA isolation (RNeasy, Qiagen) per sample ...
-
bioRxiv - Microbiology 2021Quote: ... Maize and soybean leaf and root tissue were pulverized for 2-min at a speed of 30 Hz with two 4-mm stainless balls in a TissueLyser II (Qiagen, Venlo, Netherlands). Total DNA was extracted from plant tissues with the OMEGA Mag-Bind Plant DNA Plus kit (Omega Bio-Tek ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 µl Hi-Perfect transfection reagent (Qiagen, 301707), and 1 µl of the desired (20 µM ...
-
bioRxiv - Cell Biology 2019Quote: siRNAs used were as follows: Kif5b#3 (target sequence 5′-CAGCAAGAAGTAGACCGGATA-3′; Qiagen SI00176050), Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′ ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Immunology 2019Quote: ... The aqueous phase was collected and mixed at a 1:1 ratio with 70% ethanol (Qiagen). RNA was isolated from this mixture using the RNeasy MinElute Kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of FocnCong:1-1 was isolated using CTAB and 100/G genomic tips (QIAGEN) as described in the 1000 Fungal genomes project (http://1000.fungalgenomes.org) ...
-
bioRxiv - Microbiology 2021Quote: Cellular total RNA was prepared from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Genomics 2021Quote: ... Quantification of ACE2 transcript levels was performed by preparing total RNA from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Molecular Biology 2022Quote: Viral RNA was extracted from serially diluted and the 4 different media SARS-CoV-2 samples using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH, Hilden, Germany). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 1 μl 10X Buffer (Qiagen). PCR products were digested for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... Cignal EGR-1 reporter kit (Qiagen) was transfected in HEK293T following manufacturer protocol ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...