Labshake search
Citations for Qiagen :
1 - 50 of 4884 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and 0.82 μl PCR-grade H20 (Qiagen). The plates containing single cells in lysis mix were stored at −80°C until further processing where they were thawed on ice ...
-
bioRxiv - Immunology 2020Quote: ... and 0.095 μl PCR-grade H2O (Qiagen). Reverse transcription was performed in a thermal cycler (lid temperature 70°C ...
-
bioRxiv - Microbiology 2023Quote: ... 6.5 µL of PCR grade nuclease-free water (Qiagen), and 10 µL of 2x Platinum Hot Start DNA Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2022Quote: ... single flies were homogenized in 30μL Tris-EDTA buffer pH 8.0 with 5M NaCl and Proteinase-K (proK) Qiagen solution (from Qiagen #69504). Samples were incubated at 37°C for 30 minutes and then at 95°C for four minutes ...
-
bioRxiv - Genetics 2020Quote: ... for PCR grade DNA or the QIAamp DNA mini kit (Qiagen) for WGS grade DNA according to the manufacturers’ protocols ...
-
bioRxiv - Immunology 2020Quote: ... 0.125 μl 20 μM SmarterR reverse primer (30) and 1 μl PCR-grade H2O (Qiagen). The amplification was performed in a thermal cycler (lid temperature 98°C ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR was performed using Taq DNA polymerase with Q-solution (Qiagen) and enzymatic clean-up of PCR products was performed using Exonuclease I (ThermoScientific ...
-
bioRxiv - Genomics 2022Quote: ... or Multiplex PCR Plus Kit with Q-solution (Cat# 206152, Qiagen) for PCR and always used a temperature gradient to optimize the annealing ...
-
bioRxiv - Evolutionary Biology 2023Quote: The DNA solution was purified by MinElute PCR Purification Kit (QIAGEN) following the instruction with pre-heated (60°C ...
-
bioRxiv - Genetics 2023Quote: ... and the solution then concentrated using the MinElute PCR Purification kit (Qiagen) and DNA eluted in 60 μl ...
-
bioRxiv - Genetics 2023Quote: ... We used the Taq PCR Core Kit with Q solution (Qiagen, 201225) with 5 µL of the isolated genomic DNA following PCR conditions ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl of amplified cDNA from each well of a 96-well plate were pooled and completed to 500 μl with PCR-grade H2O (Qiagen). Two rounds of 0.6X solid-phase reversible immobilization beads (AmpureXP ...
-
bioRxiv - Immunology 2020Quote: ... cleaning were used to purify 100 μl of pooled cDNA with final elution in 15 μl PCR-grade H2O (Qiagen). After quantification with Qubit dsDNA HS assay (Thermofisher) ...
-
bioRxiv - Genomics 2023Quote: ... Isolated colonies were suspended in PCR-grade water for the following automated DNA extraction using QIAcube and QIAmp mini kit (QIAGEN). The DNA extracts were used for SBT ...
-
bioRxiv - Genetics 2020Quote: ... Analyses of HTT CAG repeat size in both HttQ111 mice and in patient fibroblasts was performed by PCR using human-specific HTT primers and Taq PCR Core Kit with Q solution (Qiagen), as previously described (17 ...
-
bioRxiv - Genetics 2024Quote: ... The first PCR amplified from HTT to GFP (F: ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC, R: GTCCAGCTCGACCAGGATG) Taq PCR Core Kit with Q solution (Qiagen) with 5 µL of the genomic DNA with initial denaturation 95°C (5 min) ...
-
bioRxiv - Genomics 2022Quote: Genomic DNA was extracted using the Blood & Cell Culture DNA Mini (<5M cells) Kits (Qiagen, cat. no. 13323) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Microdissection was performed manually on the tumour Gleason grades marked FFPE areas using a sterile injection needle and deparaffinized using deparaffinization solution (Qiagen, Catalog number – 19093). RNA extraction was performed using the miRNeasy FFPE kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... a total of 20 μl PCR solution was mixed with 10μl HotStartTaq Master Mix (Qiagen, containing 1 unit of HotStartTaq DNA Polymerase ...
-
bioRxiv - Developmental Biology 2020Quote: ... protein-DNA crosslinks were reversed with the addition of 5M NaCl and heating on a shaker incubator overnight and purified using Qiaquick columns (Qiagen). DNA was eluted in 100µl of 10mM Tris-HCl and 2.5 to 5 µl aliquots were used in qPCR analyses ...
-
bioRxiv - Physiology 2024Quote: ... with 250uL LCMS-grade water and 215uL LCMS-grade MeOH containing 10uL SPLASH lipidomix standard (Avanti #330707) and homogenized in a TissueLyzer (Qiagen) at 4C ...
-
bioRxiv - Cancer Biology 2020Quote: ... amplification grade (1 U/µg RNA, Qiagen, #79254). Real-time qPCR was performed with a MyiQ™ instrument (BIO-RAD) ...
-
bioRxiv - Microbiology 2023Quote: ... Each reaction contained 5 μL DNA solution and PCR mixture with Taq Type-it (Qiagen®). PCR products were analyzed by capillarity electrophoresis on an ABl3130xl sequencer ...
-
bioRxiv - Immunology 2023Quote: ... A second round of PCR was performed to generate uniquely barcoded sequencing libraries using the barcode primer plate included in the kit (17μL of working mix which include 12.5μL QIAGEN 2x Multiplex PCR master mix, 2.5μL QIAGEN 5x Q-solution and 2μL of QIAGEN RNase-free water ...
-
bioRxiv - Genomics 2020Quote: ... at which point we combined the resulting solution with 12 mL of PB buffer and followed standard MinElute PCR Purification Kit (Qiagen) protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... the transposed DNA fragments were extracted from the reaction solution using the Mini Elute PCR purification kit (Qiagen Cat# 28004) and then amplified by a 12-cycle PCR amplification step with specific primers as described by Buenrostro et al. ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: ... The retrieved tissue mROIs were deposited with 2 µl PBS into PCR tubes containing 18 µl of lysis buffer: 1:16 mix of Proteinase K solution (QIAGEN) in PKD buffer (QIAGEN) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue microregions were deposited with 2 µl PBS into PCR tubes containing 18 µl of lysis buffer: 1:16 mix of Proteinase K solution (QIAGEN) in PKD buffer (QIAGEN) ...
-
bioRxiv - Molecular Biology 2023Quote: ... expanded and initially screened for correct integration using homology- arm spanning PCRs (Immolase DNA polymerase, Bioline, supplemented with Q solution, Qiagen). Genotypes of positive clones were confirmed by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligonucleotides were incubated with a PCR mix containing (100 µM dNTP, 1X thermopol Taq reaction buffer, 1X of Q solution (Qiagen) and 1 µM of each primer) ...
-
bioRxiv - Genetics 2020Quote: ... Total RNAs were treated with amplification-grade RNase-free DNase I (Qiagen) to remove contaminating DNAs ...
-
bioRxiv - Microbiology 2020Quote: ... an aliquot of the extracted RNA solution was added to the reaction mixture for the QuantiTect probe RT-PCR kit (Qiagen, Hilden, Germany), which contained 2x QuantiTect probe RT-PCR master mix ...
-
bioRxiv - Genetics 2023Quote: ... PCR product was purified by PCR QIAquick PCR Purification Kit (QIAGEN) and subjected to MiSeq (Center for Computational and Integrative Biology DNA Core ...
-
bioRxiv - Microbiology 2024Quote: ... PCR amplicons were PCR-purified using QIAquick PCR Purification Kit (Qiagen) and submitted for mechanical shearing (Covaris ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR amplification (Qiagen, Taq PCR Core Kit) was used to create more copies with a T7 promoter that was added to the 5’ end of the forward primer ...
-
bioRxiv - Microbiology 2023Quote: ... PCR purification (Qiagen QIAquick PCR Purification Kit) was used to isolate the linearized PCR product ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR purified (QIAquick PCR Purification kit, QIAGEN), and used in T7 reverse transcription reactions (MEGAscript ...
-
bioRxiv - Genetics 2021Quote: ... Protein Precipitation Solution (Qiagen) was added at 0.33x and mixed well ...
-
bioRxiv - Genetics 2024Quote: ... 1X Q-Solution (Qiagen), 200 µM dNTP (Qiagen) ...
-
bioRxiv - Genetics 2024Quote: ... 1X Q-Solution (Qiagen), 200 µM dNTP (Qiagen) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The PCR products were purified using the PCR QIAquick PCR cleanup kit (Qiagen, 28106) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... The linearized PCR product was isolated through PCR purification (QIAquick PCR Purification Kit, Qiagen), followed by a dual digestion with DpnI and XhoI to remove residual WT plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... Animal genotyping PCR (Taq PCR Master Mix, Qiagen) samples were run on either 0.8% or 2.0% agarose gels ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was purified (Qiagen PCR purification Kit) and eluted in 50 μl of 0.1 M NaHCO3 solution ...
-
bioRxiv - Microbiology 2023Quote: ... Following PCR purification (Qiagen QiaQuick PCR Purification Kit), cDNA was processed at the ENPRC core for sequencing on an Illumina NovaSeq 6000 platform ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified (Qiagen PCR purification kit) and assembled with pMV306hyg that was linearized by digestion with NcoI using HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were purified (PCR purification kit, Qiagen) and used as templates for T3 and T7 transcription reactions (Megascript ...
-
bioRxiv - Cancer Biology 2020Quote: ... 11.5 μl of molecular grade H2O and 0.1 μl HotStarTaq DNA Polymerase (Qiagen, Cat# 203203). Reactions were incubated at 95°C for 15 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection-grade plasmid DNA was purified using the QIAGEN plasmid plus Midiprep kit (QIAGEN, USA).
-
bioRxiv - Microbiology 2020Quote: ... PCR was followed by PCR purification using a QIAquick PCR Purification kit and protocol (Qiagen). About 50 ng of cleaned PCR product of either DENV2 or ZIKV was separately cloned into a TOPO-TA PCR cloning vector (ThermoFisher Scientific ...