Labshake search
Citations for Qiagen :
551 - 600 of 1202 citations for 5 tert butoxy 5 oxopentanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Total RNA was extracted from approximately 5-10 million cells from each organ using the RNeasy Mini Kit (QIAGEN). SuperScript® IV Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Genetics 2023Quote: ... medium was removed using the Bluewasher (BlueCatBio) and cells were lysed for 5 min using RLT plus buffer (Qiagen), snap frozen on dry ice and stored at −80 °C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR mix contained 0.16 µM of each of the fluorescent universal primer and of the reverse specified primer and 0.04 µM of the 5’ tail forward primer in a final 15 µl reaction volume (2x QIAGEN Multiplex PCR Master Mix with 3 mM Mg2+ ...
-
bioRxiv - Microbiology 2024Quote: ... Total cellular DNA was extracted from approximately 0.5 to 5 million cells using a QIAamp DNA Blood Minikit (Qiagen). PCR assays were performed with 200 ng samples of DNA ...
-
bioRxiv - Biochemistry 2024Quote: ... The lysate was pelleted by centrifugation at 30,000 x g for 30 min and the supernatant was mixed with 5 mL Ni-NTA resin (Qiagen) pre-equilibrated with lysis buffer in a 50 mL falcon tube ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was filtered through a 0.45 µm syringe filter and applied to a 5 ml Ni-NTA agarose column (Qiagen) pre-equilibrated in Lysis-Wash buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... Supernatants were filtered through a 0.22 µm syringe filter before application to 5 ml of nickel resin (Ni-NTA Superflow, QIAGEN) equilibrated in loading buffer (25 mM HEPES-KOH pH 7.6 ...
-
bioRxiv - Immunology 2021Quote: ... Ni-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) was used to purify the protein via gravity flow and proteins were eluted as previously described37,38 ...
-
bioRxiv - Microbiology 2021Quote: ... and associated nucleic acid extraction (Qiagen, Germany) kits were used ...
-
bioRxiv - Genomics 2024Quote: ... and QIAamp Circulating Nucleic Acid Kit (Qiagen) for EAC samples ...
-
bioRxiv - Plant Biology 2020Quote: Quantitative real-time PCR was performed in a volume of 5 mL QuantiTect Probe PCR Kit (Qiagen GmbH, Hilden, Germany) kit and an ABI 7900HT fast real-time PCR system (ThermoFisher Scientific Inc. ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was collected and subjected to affinity purification using 5 mL Hi-Trap column containing Ni-NTA resin (Qiagen) on an AKTA Pure 25L protein purification system (GE Healthcare) ...
-
bioRxiv - Biochemistry 2021Quote: ... and cDNA products containing the R2R adapter attached to their 5′ end were cleaned-up by using a MinElute column (Qiagen) to remove unused primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Genetics 2021Quote: ... and E11 (5’-AGGAAAAAGGAAATAAATTA-3’) primers on pDH373 as a template generated a smaller fragment that was cleaned up by QIAGEN MinElute PCR Purification Kit (#28004) ...
-
bioRxiv - Genetics 2021Quote: Pools of 5 mites were ground to powder in liquid nitrogen and total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... E18.5 RNA was extracted from cortices of 3 genotypic conditional knockouts and 4 controls using the RNeasy Micro Kit (Qiagen). RNA was reverse transcribed to cDNA using the SuperScript™ II Reverse Transcriptase Kit (Invitrogen) ...
-
bioRxiv - Genetics 2020Quote: ... in a 2 ml Eppendorf (Hamburg, Germany) tube using Stainless Steel Beads (5 mm) and the TissueLyzer (QIAGEN, Venlo, Netherlands). After an incubation time of 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were transfected at 60-80% confluence with 5 nM/1nM (MIN6, EndoCβ-H1, respectively) control or miR-125b mimics (Qiagen) or 50 nM of a mixture of four ONTARGETplus siRNAs against mouse Smad2 ...
-
bioRxiv - Microbiology 2019Quote: ... Epithelial cells were then recovered and stabilised by pelleting at 1000 rpm for 5 minutes followed by lysis in buffer RLT RNA lysis solution (Qiagen).
-
bioRxiv - Biochemistry 2021Quote: ... The RNA was prepared from 5 OD equivalents of stressed and unstressed cells using the RNeasy Plus RNA Isolation Kit (Qiagen). 500 ng RNA of the total isolated RNA were used as a template for the synthesis of cDNA using Oligo(dT ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were then aspirated using a freshly flame-pulled patch pipette (2.5 inner diameter) and placed into a 5 μl of lysis Buffer TCL (Qiagen, 1031576) + 1% 2-mercaptoethanol (Millipore-Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... LRRCC1-si2 (target sequence: 5’- TTA GAT GAC CAA ATT CTA CAA - 3’) and control siRNA (AllStars Negative Control) were purchased from Qiagen. siRNAs were delivered into cells using Lipofectamine RNAiMAX diluted in OptiMEM medium (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from frozen mouse liver (20-25 mg) and HepG2 cells (5-6 million) using the AllPrep DNA/RNA Mini Kit (QIAGEN) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... Approximately 20 mg of jejunum were mixed with 600 μL of the prepared protein lysis buffer and homogenized using 5 mm stainless steel beads (Qiagen) and a TissueLyser II system (Qiagen) ...
-
bioRxiv - Genetics 2019Quote: Total RNA was isolated from adult anaemic spleen 5 days after phenylhydrazine injections [56] using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: DNA and RNA were extracted from the cervical cancer tissues (5-10 mg) using the AllPrep DNA/RNA Micro Kit (QIAGEN) as described by the manufacturer ...
-
bioRxiv - Immunology 2019Quote: ... longitudinal muscle/myenteric plexus preparations were homogenized in a 2 ml eppendorf containing 1 ml Trizol and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Immunology 2019Quote: ... mucosal scrapings and feces were homogenized in a 2 ml eppendorf containing 1 ml of DNA extraction buffer and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Microbiology 2019Quote: ... 3 and 5 dpi maize leaves were ground in liquid nitrogen and total DNA was isolated with DNeasy Plant Mini kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs used were: AllStars Negative control siRNA (cat# 1027281) and si-Rab13 #8 (cat# SI02662702; target sequence: 5’-ATGGTCTTTCTTGGTATTAAA-3’) from Qiagen.
-
bioRxiv - Microbiology 2019Quote: ... total RNA was extracted from 1∼5 million PBMCs into 30ml of water with RNeasy Mini Kits (Qiagen, Valencia, CA). For unbiased repertoire analysis ...
-
bioRxiv - Genomics 2019Quote: ... We used a 100 µm nozzle to sort single cells into 96-well plates containing 5 µl TCL buffer (Qiagen) with 1% beta-mercaptoethanol for Smart-seq2 and 384-well plates containing 0.6 µl 1% NP40 (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and dARC1 CA captured from clarified lysate using immobilised metal ion affinity on a 5 mL Ni2+-NTA superflow column (Qiagen). Bound dARC1 CA was eluted in non-reducing buffer (50 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 ng equivalent of pooled total RNA (5 slices per animal; 7 rats) was used to synthesize cDNA using an RT First Strand Kit (Qiagen). Pre-validated primers targeting rat CXCR4 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The entire flies were mechanically crushed for 30 s at 25 Hz using a 5-mm stainless steel bead in a TissueLyser (Qiagen). Three hundred μL of ACL solution and 20 μL of 16 g.L-1 proteinase K were then added to the samples ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 250 plants showing the long root phenotype of the revertant were selected at 5 DAS and pooled for DNA extraction using the DNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... followed by flow sorting with a Sony SH800Z (gating on calcein NVOC fluorescence levels) into individual wells of a 96-well plate containing 5 μL of Buffer RLT (Qiagen) and 1% β-mercaptoethanol.
-
bioRxiv - Cancer Biology 2021Quote: Driver mutations were derived from.15 CopyNumbers were calculated using the CNVKit package.16 RNA was isolated from cell cultures (+/− 5 μM AGI-5198) using the RNeasy kit (Qiagen). We performed paired-end sequencing of 2×100 with the Illumina Novaseq platform to obtain 8-10 GB per sample ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 to 20 mg of frozen tissue was dissociated using 400 μl of RLT Plus in a 2mL extraction tube containing a 5 mm diameter beads (Qiagen) and agitated at 30 HZ for twice 2 minutes in the TissueLyser II (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... a volume equivalent to 5×108 cells were spun down (assuming 1 OD600=8×108 cells) and Protect Bacteria RNA Mini Kit (Qiagen) was used to extract total RNA as described in (Bhattacharyya et al. ...
-
bioRxiv - Cancer Biology 2019Quote: Tumour tissue were collected into 2 ml tubes with pre-chilled steel beads (Qiagen Stainless Steel Beads, 5 mm, 69989) and stored at −80 °C freezer ...
-
bioRxiv - Neuroscience 2020Quote: RNA was extracted from third-instar larval CNS or adult heads (5-7 days post-pupation) with RNeasy Plus Micro kit (Qiagen). RNA isolation was followed with DNase digestion with Turbo DNA-free (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Bacterial cultures (5 to10 mL) from mid-exponential phase (OD600 = 0.5-0.6) were harvested and treated with RNAprotect reagent (Qiagen, Germantown, MD), and the cell pellet ...
-
bioRxiv - Microbiology 2020Quote: ... mexicana Cas9 T7 procyclic promastigotes were transfected either with whole PCR reactions or 5 µL of DNA purified using the QIAquick PCR Purification Kit (Qiagen). 8 x 106 log phase cells were prepared by spinning down (1,000 x g for 10 min) ...
-
bioRxiv - Systems Biology 2021Quote: ... 0.5-1 μg of total RNA was reverse transcribed into first-strand cDNA using an RT2 First Strand Kit (QIAGEN). The resultant cDNA was subjected to qPCR using human cytokine-specific primer (Realtimeprimers.com ...
-
bioRxiv - Microbiology 2020Quote: ... Purified extracellular WT and Δtgif2k-b tachyzoites were treated with vehicle or 5 μM sodium arsenite for 2 h at 37°C and total RNA was extracted using RNeasy (Qiagen). The RNA concentration for each sample was measured using Nanodrop One (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2020Quote: ... All other tissues were homogenized in a SPEX CertiPrep 2010-230 Geno/Grinder (Cat No.: 12605297, Fischer Scientific) using 5 mm steel beads (Cat No.: 69989, Qiagen); tubes were shaken in 20 sec bursts at 1500 rpm ...
-
bioRxiv - Plant Biology 2021Quote: RNA was isolated from adult (5-week-old) WT and er/erl1/erl2 plants using a Plant RNeasy kit (Qiagen) according to the manufacturer’s protocol ...