Labshake search
Citations for Qiagen :
151 - 200 of 3026 citations for 5 OXO 5 6 7 8 TETRAHYDRO NAPHTHALENE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM Primer and 1 μl DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl Polyfect Transfection Reagent (Qiagen, catalog # 301105) was added ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 mm stainless steel beads (Qiagen, #69989). Lysates were incubated for 2 h at 37°C protected from light ...
-
bioRxiv - Genomics 2019Quote: ... All wells were then pooled and diluted 5:1 (∼24 mL) in Buffer PB (Qiagen #19066) with 1/20th volume of 3 M NaOAc pH 5.2 (∼1.2 mL) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... The bacterial lysates were mixed for 1 h with 5 ml of Ni-NTA resin (Qiagen) that had been equilibrated with buffer A ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was extracted from 32D-Cas9 cell lines expressing sgRNAs targeting Cbl introns 7 and 8 using an RNeasy Mini Kit (QIAGEN, 74106). cDNA was prepared using a QuantiTect Reverse Transcription Kit (QIAGEN ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Microbiology 2020Quote: Whole genome amplifications were performed on DNA extracts at dilution 10 times through a multiple displacement amplification (MDA) step of 6 to 7 hours using the REPLI-g Midi Kit (QIAGEN) and following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was isolated from liver and lung tissues (n=4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Mini Kit (Qiagen) and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group ...
-
bioRxiv - Cancer Biology 2021Quote: ... and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Blood Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and 8 M urea [pH 8.0]) and His-tagged Tax proteins were precipitated with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen). After washing in buffer C (100 mM NaH2PO4 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from all samples (5 CTRL and 5 SCZ subjects at six timepoints across astrocyte differentiation) using either the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) or the MagMax mirVana Total RNA Isolation Kit (Thermo Fisher) ...
-
bioRxiv - Genomics 2019Quote: In order to screen for the presence of the Alu element in exon 4 of RP1 distinct pair of primers were designed (forward: 5′-AGGCTTGTTTCCTAGGAGAGGT-3′, reverse: 5′-TTCTGCTTCTTTTTCACTTAGGC-3′) using the CLCbio Genomics Workbench (Qiagen, Hilden, Germany).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 0.1 g of tissue per 1 mL of PBS was homogenized with stainless steel beads of 5 mm (25–30 Hz for 5 min) by a Tissuelyser (Qiagen, Venlo, Netherlands). The homogenates were centrifuged at 10,000 x g for 10 min and the supernatant was collected and stored at −80 °C until CD quantification ...
-
bioRxiv - Microbiology 2020Quote: ... region was amplified using fungal-specific primers (60): ITS1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) and the HotStarTaq Plus Master Kit (Qiagen, Valencia, CA). Amplicons from different samples were pooled to equimolar concentrations and purified of short fragments using Agencourt Ampure beads (Agencourt Bioscience Corporation ...
-
bioRxiv - Microbiology 2022Quote: ... of the 16S rRNA gene that amplified via PCR using primers 338F (Seq: 5’-ACTYCTACGGRAGGCWGC-3’) and 1061R (Seq: 5’-CRRCACGAGCTGACGAC-3’) with the HotStar HiFidelity Polymerase Kit (catalog number 202602; QIAGEN, Hilden, Germany). Supplementary Figure 1 shows the 16S rRNA gene map and the primers used ...
-
bioRxiv - Microbiology 2024Quote: ... IFAS and LifeGuard Soil Preservation were transferred into a 5 mL bead beating tube from DNeasy PowerWater kits for 5-minutes of vortexing (Qiagen, Hilden, Germany). Afterwards ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized in groups of 3-5 flies by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml 1X PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Genomic DNA (gDNA) was extracted from 1-5×106 cells using DNeasy Blood and Tissue Kit (Qiagen) and 250 ng gDNA ...
-
bioRxiv - Synthetic Biology 2021Quote: mESC gDNA was purified from 1-5 million cells using the QIAamp DNA mini kit (Qiagen 51306) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... samples were defrosted and incubated in 1 ml of RNAprotect cell reagent (Qiagen, 5 min, 25°C). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... Ligation of 1 µl 5′RACE PCR products were performed with the Qiagen PCR cloning kit (Qiagen) according to the manufacters protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 5 ml of the supernatant were added to 1 ml of Nickel-NTA Agarose (Qiagen, Hilden, Germany) and incubated under continuous shaking at 4 °C for 1 h ...
-
bioRxiv - Developmental Biology 2021Quote: ... we added a 5-mm stainless steel bead (QIAGEN) and 100 μl of PBS to each tube and lysed the samples by TissueLyser II (QIAGEN ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μg total RNA was treated with DNase (Qiagen) and purified (RNeasy Kit ...
-
bioRxiv - Cell Biology 2021Quote: ... A single sterile 5 mm stainless steel bead (Qiagen) was added to each tube ...
-
bioRxiv - Neuroscience 2022Quote: ... and added 5 volume PB including pH-indicator (Qiagen) and 200 μL sodium-acetate (3M ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1 µl Hot Start Polymerase (Qiagen, 5 U/ µl), 20 ng/µl DNA template (95°C for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... siWDR1 (5’-GGTGGGATTTAGGCAATTATT) and AllStars Negative Control siRNA (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of Taq PCR Master Mix kit (Qiagen), 0.4 μl of each primer (100 pmol/μl ...
-
bioRxiv - Cell Biology 2019Quote: ... Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′; Qiagen SI00176057), and non-target (NT ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... A 5 ml Strep-tactin Superflow Plus column (Qiagen) was equilibrated with 50 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... with a 5 mm diameter stainless steel bead (Qiagen) for a total of 6 min (2 x 3 min with 1 min on ice in between homogenisations ...
-
bioRxiv - Immunology 2021Quote: ... Plates contained 5 µl of TCL lysis buffer (Qiagen) supplemented with 1%β-mercaptoethanol ...
-
bioRxiv - Genomics 2021Quote: ... 5 μl of nuclease free water (Qiagen, Hilden, Germany) and 5 μl of template RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a 5 mm stainless steel bead (Qiagen #69989) in an RNase-free microcentrifuge tube ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 5 mm stainless steel beads (QIAGEN Cat#69989). To these tubes ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 µl SYBR Green Mix (Qiagen N.V., Venlo, Netherlands), and 3 µl nuclease-free water (total volume ...
-
bioRxiv - Physiology 2023Quote: ... and homogenized using 5-mm steel beads (Qiagen #69989) in a bead mill (Qiagen TissueLyser LT) ...
-
bioRxiv - Microbiology 2023Quote: ... 5×105 cells were lysed in RLT buffer (QIAGEN) with 10 μL of β-mercaptoethanol ...
-
bioRxiv - Microbiology 2020Quote: ... The 6 × his-tagged proteins were purified using a nickel-nitrilotriacetic acid (Ni-NTA) agarose matrix (30250, Qiagen). Cell-free extracts were loaded on 0.5 ml Ni-NTA matrixes and incubated on a roller shaker for 2 h at 4 °C ...
-
Cell-free DNA as a biomarker for prostate cancer: elevated concentration and decreased fragment sizebioRxiv - Cancer Biology 2020Quote: ... DNA was extracted from 7 to 55 mL of plasma using the Qiagen QIAamp Circulating Nucleic Acid Kit (Qiagen, Redwood City, CA), and double eluted with 40 μL of Qiagen Elution Buffer ...
-
bioRxiv - Microbiology 2023Quote: The amino acid sequences of coronavirus spike orthologues were subjected to multiple alignment using CLC Workbench 7 (CLC Bio, Qiagen, Aarhus, Denmark). Protein sequence NCBI reference sequences for the indicated viruses are as follows ...
-
bioRxiv - Microbiology 2021Quote: ... prior to the addition of proteinase K and 5 μl of 100 mg ml−1 RNase A (Qiagen). The DNA concentration was determined using a Qubit fluorometer (Thermo Fisher Scientific ...