Labshake search
Citations for Qiagen :
1 - 50 of 1796 citations for 5 M TOLYL FURAN 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... and homogenized twice at 10 s at 2 M/s with a 5-mm steal bead (Qiagen) using a tissue homogenizer (MP Biomedicals) ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Genomics 2022Quote: ... The reactions were incubated for 15 min at 60 °C and then terminated by adding 1 μl 5 M NaOH to degrade RNA and heating at 95 °C for 5 min followed by neutralization with 1 μl 5 M HCl and one round of MinElute column clean-up (Qiagen). The R1R DNA adapter was adenylated by using a 5’ DNA Adenylation kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Cancer Biology 2021Quote: ... sections were incubated in 0.08 M KOH for 5 min and washed by Buffer EB (Qiagen). Then ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.8□l of forward and reverse primer at 5□M concentration and 10□l QuantiNova (Qiagen), made up to a final volume of 20□l with nuclease-free water ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: IQN17 was crystallized at room temperature in a hanging-drop vapor diffusion system by mixing 0.3 μL of 15 mg/mL peptide with 0.3 μL of reservoir solution containing 0.1 M imidazole (pH 8.0) and 35 % 2-methyl-2,4-pentanediol (MPD) (Qiagen). Crystals were seen two days after trays were set up ...
-
bioRxiv - Cancer Biology 2022Quote: ... each well was incubated in 75 μL 0.08 M KOH for 5 min and washed with 100 μL EB buffer (QIAGEN) at room temperature (RT) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The kidneys were homogenized using 0.5 M acetic acid and two 5-mm steel beads in TissueLyser LT (Qiagen), followed by addition of pepsin to 0.1 mg/ml and incubation for 3 days ...
-
bioRxiv - Cancer Biology 2022Quote: ... to produce 75-base pair single-end reads with aimed mean sequencing depth of >5 M reads per sample as recommended by the manufacturer (Qiagen).
-
bioRxiv - Genetics 2023Quote: ... Genomic DNA Extraction and Purification: Genomic DNA was extracted from 5 M cells using the Gentra Puregene Cell Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... genomic DNA was de-crosslinked in ChIP elution buffer containing 5 M NaCl at 65 °C overnight and purified with the Qiaex II kit (Qiagen, 20021) and eluted in water for PCR amplification ...
-
bioRxiv - Pathology 2022Quote: ... with stainless steel beads (2×5 mm) using a TissueLyser (Qiagen, Germantown, MD) for three minutes at 25 r/s twice ...
-
bioRxiv - Microbiology 2020Quote: ... with 2 × 5 mm stainless steel beads using the TissueLyser (Qiagen, Hilden, Germany) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 2–5 min with steel balls in a tissue lyser (Qiagen, Germany). Tissue lysates were incubated with the buffer at 4°C overnight (cell samples were incubated in lysis buffer for 30 min at 4°C) ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Microbiology 2020Quote: ... 0.1 M Tris (pH 7.0) (QIAGEN), 30% PEG 3000 (QIAGEN ...
-
bioRxiv - Immunology 2019Quote: ... approximately 25 mg of tissues were homogenized in 2 mL tubes containing 600 μL of Buffer RLT with 2% β-mercaptoethanol and a stainless steel bead (5 mm, Qiagen) using a TissueLyser II system (Qiagen) ...
-
bioRxiv - Genetics 2019Quote: ... and supernatant was mixed with 10 times its volume of “2M70” binding buffer (2 M guanidine hydrochloride and 70% isopropanol) in a 15 mL tube and passed through QIAquick silica columns (Qiagen, Hilden, Germany) using 25 mL tube extenders (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 600 µl of lysis buffer (TES (0.1 M TRIS, 10 mM EDTA, 2% sodium dodecyl sulphate; pH 8) and Proteinase K (Qiagen, 20 mg/ml) in a 20:1 ratio ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... The complex was initially crystallized in a buffer 0.1 M MES pH 6.5 and 0.6 M sodium fluoride from Anions Suite crystallization screen (Qiagen). After optimization of crystallization conditions ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131) overnight ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 (2×106 cells/well) using the RNeasy Mini Kit (Qiagen) with DNase I treatment to eliminate DNA contaminants as previously described18 ...
-
bioRxiv - Microbiology 2023Quote: Cellular RNA of 2-5×105 cells was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... for lysis in 2 ml safe-lock tubes containing one 5 mm stainless steel bead (Qiagen) for 2.5-3 minutes at 30 Hz using TissueLyzer II (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 h time points were immediately mixed with 2 x volume of RNAProtect® (Qiagen) using the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNAs used were RAPH1 siRNA #2 (Hs_RAPH1_2, SI00698642) and RAPH1 siRNA #5 (Hs_RAPH1_5, SI04300982) provided by Qiagen.
-
bioRxiv - Cancer Biology 2023Quote: Each qPCR reaction consisted of 5 μL of 2× QuantiNOVA SYBR Green PCR master mix (Qiagen), 0.5 μL of 10 μM forward and reverse primers each ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.9 M KOAc [pH 4.8] (Qiagen N3 buffer). Centrifuge sample at 23°C for 10 minutes at 14,000 x g ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.9 M KOAc [pH 4.8] (Qiagen N3 buffer). Centrifuge sample at 23ºC for 10 minutes at 14,000 x g ...
-
bioRxiv - Cell Biology 2020Quote: ... His6-SUMO-WASHC2C-5-SNAP was purified using lysis buffer #2 and Ni-NTA-agarose beads (Qiagen). The protein was incubated with Ni-NTA beads and washed with 50 mM imidazole ...
-
bioRxiv - Genomics 2024Quote: RNA was extracted from 2-5 million flash frozen cells using the RNeasy plus mini kit (Qiagen). Libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (New Englands Biolabs) ...
-
bioRxiv - Microbiology 2019Quote: ... Influenza virus nucleic load was determined by qRT-PCR using influenza virus segment M specific primers (IAV-M; Table. 1) in 96-well plates according to the manufacturer instructions (OneStep RT-PCR, Qiagen, Toronto, Canada). Absolute quantification was performed using a standard curve based on a 10-fold serial dilution of a plasmid containing the A/Guinea Fowl/129/2015(H5N9 ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 M Tris/HCl pH 8.5 (JCSG+ suite, Qiagen). Hanging drops of 1 ml protein at 2 mg/ml and 1 ml of precipitant (19% (w/v ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 200 ng psiCHECK-2 reporter plasmid were co-transfected with 5 µl miScript miRNA mimics (Qiagen; CatNo. 219600) using 4 µl Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of cDNA was then added to a PCR mix containing 12.5 μl 2× Multiplex PCR mix (Qiagen), 9 μl H2O ...
-
bioRxiv - Genomics 2023Quote: MII oocytes and 2-cell embryos were individually lysed and flash-frozen in 5 μl RLT Plus buffer (Qiagen) and stored at −80°C until further use ...
-
bioRxiv - Genetics 2020Quote: ... in a 2 ml Eppendorf (Hamburg, Germany) tube using Stainless Steel Beads (5 mm) and the TissueLyzer (QIAGEN, Venlo, Netherlands). After an incubation time of 5 min ...
-
bioRxiv - Immunology 2019Quote: ... longitudinal muscle/myenteric plexus preparations were homogenized in a 2 ml eppendorf containing 1 ml Trizol and a single 5 mm steel bead in a TissueLyzer (Qiagen) for 3 min at 30 Hz ...
-
bioRxiv - Cancer Biology 2019Quote: Tumour tissue were collected into 2 ml tubes with pre-chilled steel beads (Qiagen Stainless Steel Beads, 5 mm, 69989) and stored at −80 °C freezer ...
-
bioRxiv - Microbiology 2020Quote: ... Purified extracellular WT and Δtgif2k-b tachyzoites were treated with vehicle or 5 μM sodium arsenite for 2 h at 37°C and total RNA was extracted using RNeasy (Qiagen). The RNA concentration for each sample was measured using Nanodrop One (Thermo Scientific) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... ∼2.5×108 cells (0.5 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Microbiology 2022Quote: L cell monolayers were disrupted by scraping and pelleted at 200 x g for 5 min before RNA was isolated from 2 x 105 cells using the RNeasy Plus Mini RNA extraction kit (Qiagen) per manufacturer’s protocol.