Labshake search
Citations for Qiagen :
1 - 50 of 1281 citations for 5 Isoxazolemethanol 3 3 fluorophenyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Microbiology 2021Quote: ... NG1 (5’ACCGACCACAGGGGG-3’) and NG2 (5’-GGTTGTAAACCTCTTTCGA-3’) and HotStarTaq® Master Mix Kit (Qiagen) up to a final volume of 25 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’, Qiagen), si-uS19 (5’-UCACCUACAAGCCCGUAAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-eS4X (5’-CUGGAGGUGCUAACCUAGGAA-3’, Qiagen), si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Cell Biology 2019Quote: ... KIF4A siRNA 5’-CAGGTCCAGACTACTACTC-3’ against the 3’-UTR was obtained from QIAgen, and an optimised siRNA pool for KIF22 (KID ...
-
bioRxiv - Cell Biology 2022Quote: ... and oligo 5 (Q4) 5’-CACCGAGCTCTTCGCCGAGTA-3’ (Qiagen, SI03058272).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Cell Biology 2019Quote: siRNAs used were as follows: Kif5b#3 (target sequence 5′-CAGCAAGAAGTAGACCGGATA-3′; Qiagen SI00176050), Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′ ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Genomics 2019Quote: In order to screen for the presence of the Alu element in exon 4 of RP1 distinct pair of primers were designed (forward: 5′-AGGCTTGTTTCCTAGGAGAGGT-3′, reverse: 5′-TTCTGCTTCTTTTTCACTTAGGC-3′) using the CLCbio Genomics Workbench (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2020Quote: ... region was amplified using fungal-specific primers (60): ITS1F (5’-CTTGGTCATTTAGAGGAAGTAA-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) and the HotStarTaq Plus Master Kit (Qiagen, Valencia, CA). Amplicons from different samples were pooled to equimolar concentrations and purified of short fragments using Agencourt Ampure beads (Agencourt Bioscience Corporation ...
-
bioRxiv - Microbiology 2022Quote: ... of the 16S rRNA gene that amplified via PCR using primers 338F (Seq: 5’-ACTYCTACGGRAGGCWGC-3’) and 1061R (Seq: 5’-CRRCACGAGCTGACGAC-3’) with the HotStar HiFidelity Polymerase Kit (catalog number 202602; QIAGEN, Hilden, Germany). Supplementary Figure 1 shows the 16S rRNA gene map and the primers used ...
-
bioRxiv - Microbiology 2024Quote: ... and homogenized in groups of 3-5 flies by bead-beating with 3 x 5 mm stainless steel beads (Qiagen, Hilden, Germany) in 1 ml 1X PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... Kif5b#4 (target sequence 5′-CACGAGCTCACGGTTATGCAA-3′; Qiagen SI00176057), and non-target (NT ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Cancer Biology 2021Quote: ... a 19-mer SPRY2 target sequence (5′-AACACCAATGAGTACACAGAG-3) (QIAGEN) was used and for the control a 19-mer NSi control sequence (QIAGEN ...
-
bioRxiv - Cell Biology 2020Quote: ... For Astrin siRNA oligo #367 (5′-TCCCGACAAC TCACAGAGAAA -3′)(Qiagen) was used as described (Thein et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Microbiology 2020Quote: ... CjNC110-LNA DIG-labeled probe (/5’DigN/ GCACATCAGTTTCAT/3’Dig_N/) (QIAGEN) was added to 15 mL DIG EasyHyb™ Buffer (Roche ...
-
bioRxiv - Systems Biology 2022Quote: ... 5 μl of proteinase K (approximately 3 U, Qiagen, cat. # 19131) were added and incubated for 1 h at 56°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen, #1027281). After 72 h ...
-
bioRxiv - Cell Biology 2023Quote: ... using 30 nM Hs_LUZP1 siRNA (target sequence, 5′-CAGCGGGTGCTGAGAATTGAA-3′; QIAGEN) or 30 nM AllStars negative-control siRNA (QIAGEN) ...
-
bioRxiv - Microbiology 2019Quote: ... Real-time PCR assays were carried out in triplicate to amplify the Wolbachia wsp gene [43] and host reference gene GAPDH (378 F_ 5’-CCGGTGGAGGCAGGAATGATGT-3’, 445 R_5’-CCACCCAAAAGACCGTTGACG-3’) on a Rotor-gene Q Instrument (Qiagen, NSW, Australia). Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... and 18S rRNA (5’-GAG CGA AAG CAT TTG CCA AG-3’ and 5’-GGC ATC GTT TAT GGT CGG AA-3’) on a Roter-Gene Q (Qiagen, Hilden, Germany) with 2x AmpiGene® qPCR Green Mix Lo-ROX (Enzo Biochem ...