Labshake search
Citations for Qiagen :
51 - 100 of 1727 citations for 5 Isobutyl thiophene 2 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... and oligo 5 (Q4) 5’-CACCGAGCTCTTCGCCGAGTA-3’ (Qiagen, SI03058272).
-
bioRxiv - Microbiology 2023Quote: ... 5 μL 5× One-step RT-PCR buffer (QIAGEN), 10 μL Triton-x100 (0.3% ...
-
bioRxiv - Microbiology 2022Quote: ... Organs were homogenized by high-speed shaking in 2 mL microcentrifuge tubes filled with sterile PBS and 5/7 mm stainless steel beads using TissueLyser LT (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2020Quote: Ticks were homogenised in a 2 ml reaction tube with two 5 mm steel beads and 500 μl PBS using a Tissue Lyser II (Qiagen, Hilden, Germany) for 3 min at 30 Hz ...
-
bioRxiv - Microbiology 2020Quote: ... followed by lysis in a 2 mL sure-lock tube containing 5 mm stainless steel homogenization beads using the TissueLyser LT (Qiagen, Germantown, MD, USA) for 30 seconds at 30 hz followed by 1 min of 30 hz while keeping the sample cold ...
-
bioRxiv - Cell Biology 2023Quote: ... siCASK #5 (Qiagen cat# SI02223368 ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were quenched at different time points (2, 5, 7, 10 and 20 minutes) by the addition of 250 μL of PB buffer (Qiagen QIAquick PCR Purification Kit) supplemented with 10 mM of EGTA ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... placed into a 2 mL tube with 600 μL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989), then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 30 mg of frozen tissue was placed into a 2 ml flat bottom centrifuge tube on dry ice with a 5 mm stainless steel bead (QIAGEN Germantown, MD, USA; Cat#69989) at the bottom ...
-
bioRxiv - Microbiology 2021Quote: ... 5-plex (Qiagen, Germany), the QIAcuity One-Step Viral RT-PCR Kit (Cat No ...
-
bioRxiv - Cell Biology 2020Quote: ... + 5 μM TSO (Qiagen). Amplification of cDNA (22 amplification cycles ...
-
bioRxiv - Cell Biology 2021Quote: ... 5×10^5 EpCAM+ve cells were lysed in 350μL RTL Buffer (Qiagen) containing 143mM β-Mercaptoethanol (aided by cell searing via passage ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4C (Qiagen, SI05163977), and 20 nM HIF1A Flexitube GeneSolution siRNA (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4B (Qiagen, SI00449764), 5 nM siKDM4C (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Genetics 2021Quote: ... 5 mM Multiplex-Kit (Qiagen) and HPLC water to a total volume of 10 μL per sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 uL EB buffer (QIAGEN) was added to each well and mixed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 μl RLT (79216, Qiagen) was added ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... NG1 (5’ACCGACCACAGGGGG-3’) and NG2 (5’-GGTTGTAAACCTCTTTCGA-3’) and HotStarTaq® Master Mix Kit (Qiagen) up to a final volume of 25 μL ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 μL of Ni-NTA (Qiagen) slurry was added and the solution was incubated with light agitation at 4 °C for 50 min ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... 5 μL Qiagen master mix (Qiagen Type-It Microsatellite Kit ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 5 μL 10X PCR buffer (Qiagen), and nuclease-free water to a final volume of 50 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’, Qiagen), si-uS19 (5’-UCACCUACAAGCCCGUAAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-eS4X (5’-CUGGAGGUGCUAACCUAGGAA-3’, Qiagen), si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’ ...
-
bioRxiv - Genomics 2021Quote: ... containing 5 µl RLT plus (Qiagen) with 1% v/v β-mercaptoethanol (Biorad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with one 5 mm (Qiagen, 69989) and three 2.8 mm metal beads (Precellys ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Microbiology 2023Quote: ... incubated at 65°C for 5 min and beaten for 5 min in a bead beater (Qiagen) set at high speed ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...