Labshake search
Citations for Qiagen :
1 - 50 of 3839 citations for 4 Fluoro 5 1 pyrazolyl 2 nitrobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... purified nucleic acids were treated with 1-5 μl 1 mg/ml RNaseA (Qiagen) for 45 minutes at 37 °C to degrade RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
bioRxiv - Genomics 2023Quote: ... 1µM Template-Switching Oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” prefixes a ribonucleic acid base and “+” prefixes a locked nucleic acid base, Qiagen) then incubated using a ThermoMixer C with the following conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Molecular Biology 2021Quote: The ER-I-PpoI cells treated with 4-OHT (2.5 μM) for 1 hour were collected for extraction of the total nucleic acids using DNeasy Blood & Tissue Kits (Qiagen) or PureLink(tm ...
-
bioRxiv - Cancer Biology 2024Quote: ... additional DNA from 1-5 mL of plasma was extracted using the QIAamp® Circulating Nucleic Acid Kit (Qiagen, catalogue # 55114). Illumina sequencing libraries were constructed using SRSLY® PicoPlus DNA NGS Library Preparation Kit (ClaretBio – Cat ...
-
bioRxiv - Biochemistry 2020Quote: ... at 4°C and the supernatant was loaded onto a 1 ml nickel nitrilotriacetic acid-agarose column (Ni-NTA, Qiagen, Hilden, Germany) previously equilibrated with the corresponding lysis buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was incubated at 4 °C overnight with Ni2+-nitrilotriacetic acid resin (Qiagen) pre-equilibrated with buffer B ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Microbiology 2022Quote: ... Supernatant was applied to a 5 ml nickel-nitrilotriacetic acid column (Qiagen, Valencia, CA) that had been equilibrated with buffer A at a rate of 1 ml/min ...
-
bioRxiv - Cancer Biology 2021Quote: ... cfDNA was extracted from approximately 4□ml of plasma (QIAamp Circulating Nucleic Acid kit, Qiagen) and then constructed into sequencing libraries with end repair ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Cell Biology 2022Quote: ... A Locked Nucleic Acid (LNA) probe was used to detect centromere regions (5’-TTGGCTACACCATGAAAGCTT-3’; Qiagen). 20 μL of probe mix (250 nM LNA probe ...
-
bioRxiv - Microbiology 2024Quote: ... 4 °C) and the supernatant was loaded onto a Ni-nitrilotriacetic acid (NTA) column (Qiagen, Hilden, Germany). After a washing step (6 M urea ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified extract was supplemented with 10 mM imidazole and rotated for 2 hours at 4 °C with 1 ml of Ni-NTA beads (Qiagen). Bound protein was eluted with 10 CV of buffer L / 200 mM imidazole ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Neuroscience 2024Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was extracted from OSU-CLL cells (1.5e6 cells/mL) treated with DMSO or SpiD3 (1, 2 μM; 4 h) using the miRNeasy Mini Kit (Qiagen; Hilden, Germany) per manufacturer instructions and processed using the Universal Plus mRNA-Seq with NuQuant kit (Tecan ...
-
bioRxiv - Genomics 2020Quote: Nucleic acids were isolated from 4 mL of plasma by using a QIAamp cfDNA/RNA kit (Qiagen 55184) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Effectene (4 μL of enhancer and 5 μL of Effectene reagent; Qiagen 301427) was used to transfect 500 ng of the indicated eGFP plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-4 ml of cells were harvested at each timepoint and incubated with 2 volumes of RNAprotect (Qiagen) at room temperature for 5 minutes prior to centrifugation for 5 minutes at 4000xg 4°C ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease73 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Biochemistry 2021Quote: ... Medium was stirred for 1 hour at 4°C in the presence of 5 ml Ni-NTA Agarose beads (Qiagen, Venlo, The Netherlands) washed with 25 mM Hepes-KOH pH 7.5 ...
-
bioRxiv - Immunology 2022Quote: ... The supernatant was harvested at day 4 after transfection and incubated with Ni-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen). The purification was carried out using gravity flow column and eluted with imidazole-containing buffer as previously described57,58 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 1 μM Locked Nucleic Acid (LNA) oligo-d(T)30 (Qiagen) in primary-probe hybridization buffer composed of 40% formamide (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Genomics 2021Quote: ... cfDNA was isolated from 2 ml of plasma using either the manual QIAamp circulating nucleic acid kit (Qiagen), or the semi-automated QIAsymphony DSP Circulating DNA Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... The kidneys were homogenized using 0.5 M acetic acid and two 5-mm steel beads in TissueLyser LT (Qiagen), followed by addition of pepsin to 0.1 mg/ml and incubation for 3 days ...
-
bioRxiv - Neuroscience 2024Quote: ... Hybridization was performed at 66 °C overnight with 40 nM 5′ TYE-563-labelled locked nucleic acid (LNA)-(C4G2)2.5 probe (Exiqon Qiagen). Cells were then washed once in 2X SSC/0.1% Tween-20 for 5 minutes and three times in 0.1X SSC for 10 minutes at RT before being dehydrated as above and nuclei stained with DAPI.
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant obtained after high speed centrifugation (20 000 x g for 30 min at 4 °C) was loaded on a gravity nickel-nitrilotriacetic acid (Ni-NTA) metal affinity column (Qiagen), washed with 10 column volumes (CV ...
-
bioRxiv - Genomics 2021Quote: ... cfDNA extraction was performed using the QIAamp Circulating Nucleic Acid Kit using the 4-mL plasma protocol (Qiagen, product #55114). Prior to DNA elution ...
-
bioRxiv - Cancer Biology 2020Quote: ... we utilized 4 mL of plasma and cfDNA was isolated using the QIAamp Circulating Nucleic Acid Kit (Qiagen, Hilden, Germany). The concentration of cfDNA was determined using the Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... 45 min at 4 °C) and supernatant containing His-tagged proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) purification (Qiagen). Protein was eluted in a final elution buffer of 20 mM Tris pH 8.0 ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA) ...