Labshake search
Citations for Qiagen :
1 - 50 of 1289 citations for 3 Acetoxy 8 17 13E Labdadien 15 Oic Acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Total RNAs were extracted from 20 heads (or 15 thoraces or 15 abdomens) of 8-day-old flies using the QIAzol Lysis reagent (Qiagen). The Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: RNA at the defined stages of differentiation (day 0, 1, 5, 8, 11, 14, 17, 27, 35, 50) was extracted using RNeasy Plus mini kit (Qiagen, 74136) according to the manufacturer’s guidelines ...
-
bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
bioRxiv - Genomics 2023Quote: ... 1µM Template-Switching Oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” prefixes a ribonucleic acid base and “+” prefixes a locked nucleic acid base, Qiagen) then incubated using a ThermoMixer C with the following conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... the supernatant was incubated with 3 ml nickel- nitrilotriacetic acid Ni-NTA beads (Qiagen) preequilibrated with the same buffer overnight ...
-
bioRxiv - Microbiology 2020Quote: ... and 8 M urea [pH 8.0]) and His-tagged Tax proteins were precipitated with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen). After washing in buffer C (100 mM NaH2PO4 ...
-
bioRxiv - Neuroscience 2020Quote: ESR1 expression was manipulated with custom-designed locked nucleic acid (LNA™) 15-mer antisense oligonucleotides designed by Qiagen following Kelly & Goodson.41 The antisense oligo for ESR1 knockdown (ESR1-KD ...
-
bioRxiv - Microbiology 2023Quote: ... and the supernatant was added to 3 ml of Ni-nitrilotriacetic acid (NTA) superflow resin (Qiagen) and the mixture was applied onto a gravity drip column ...
-
bioRxiv - Cell Biology 2022Quote: ... A Locked Nucleic Acid (LNA) probe was used to detect centromere regions (5’-TTGGCTACACCATGAAAGCTT-3’; Qiagen). 20 μL of probe mix (250 nM LNA probe ...
-
bioRxiv - Neuroscience 2021Quote: ... The frozen brain tissue blocks of WRM and BF were boiled for 8 min and homogenized in 5% acetic acid using a TissueLyser LT (Qiagen) for 6 min at 50 Hz ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Developmental Biology 2022Quote: ... 14 and 17 after RA treatment using QIAshredder (Qiagen, 79654) and RNeasy (Qiagen ...
-
bioRxiv - Bioengineering 2021Quote: ... total cfDNA was extracted from 3 mL of separated plasma using the QIAamp Circulating Nucleic Acid kit (QIAGEN) following manufacturer instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... using the QIAGEN TissueLyser at 15 Hz for 2-3 min with a Stainless-Steel Bead (QIAGEN catalog # 69989). Phase separation was induced with chloroform ...
-
bioRxiv - Bioengineering 2024Quote: ... spun down for 15 s at 8,000 g and eluted 3 times by adding 700 µL Buffer RW1 (Qiagen) and spinning ...
-
bioRxiv - Microbiology 2024Quote: ... bacteria and serum mixtures were transferred into 15 ml centrifuge tubes containing 3 ml of RNAprotect Bacteria Reagent (Qiagen). After vortexing for 5 s at high speed ...
-
bioRxiv - Immunology 2022Quote: ... genomic DNA was isolated 3 or 8 days after editing by a QIAamp DNA Mini Kit or Micro Kit (QIAGEN). The genomic region flanking the CRISPR/Cas9 cleavage site was PCR-amplified ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from MSCs cultured for 3 or 15 days under different experimental conditions using RNeasy Micro Kit (Qiagen). RNA quantity and integrity was measured with a NanoDrop 1000 (ThermoScientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... elastase (3.125 U/mL, Serva) and DNAse (17 U/mL, Qiagen) for 20 min at 37°C while shaking (750 rpm) ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Cell Biology 2021Quote: Formalin-fixed paraffin-embedded tissues were used for in situ hybridization (ISH) employing locked nucleic acid (LNA) probes labelled with digoxigenin (DIG) at both the 5′- and 3’-ends (Qiagen). ISH was performed with probes specific for miR-132-3p (10 nM ...
-
bioRxiv - Cancer Biology 2024Quote: ... EV RNA was eluted in 17 μL of nuclease-free water (Qiagen) and assessed for concentration and purity with Bioanalyzer Agilent RNA 6000 Pico Kit.
-
bioRxiv - Physiology 2024Quote: RNA was isolated from frozen placentas (Control n = 8; MNR n = 8; MNR + hIGF1 n = 8) using the RNeasy mini kit (Qiagen), including DNAse treatment ...
-
bioRxiv - Developmental Biology 2020Quote: ... 17 and 25 (hiPSC-derived myotube) using the miRNeasy Mini kit (217004, QIAgen) on the QIAcube instrument ...
-
bioRxiv - Immunology 2024Quote: ... Nickel nitrilotriacetic acid (Qiagen) agarose beads were washed in TBS and added to filtered supernatant at a ratio of 2-3 mL resin/L and incubated on a rotator over-night at 4°C ...
-
bioRxiv - Systems Biology 2023Quote: ... paired-end (37:8:8:38) RNA-sequencing using a RNeasy Micro kit (Qiagen #74004) for RNA extraction ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 17-20 days after fertilization (20 dpf) using RNeasy Mini Kits (Qiagen catalog #74104). For samples collected at 2 dpf ...
-
bioRxiv - Molecular Biology 2023Quote: ... Library pools are denatured by combining 17 µl of 10mM TRIS buffer (Qiagen buffer EB) with 1 µl 2M NaOH and 2 µl of the 2000 LCT/ µl library pools and incubated at RT for 5min ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Bioengineering 2022Quote: ... We conducted standard bulk paired-end (37:8:8:38) RNA sequencing using RNeasy Micro (Qiagen, 74004) for RNA extraction ...
-
bioRxiv - Systems Biology 2021Quote: We conducted standard bulk paired-end (37:8:8:38) RNA sequencing using RNeasy Micro (Qiagen 74004) for RNA extraction ...
-
bioRxiv - Immunology 2023Quote: ... and 15 µl of HiPerFect (Qiagen) transfection reagent was added ...
-
bioRxiv - Microbiology 2022Quote: ... and loaded onto Biosprint 15 (Qiagen) for purification ...
-
bioRxiv - Microbiology 2022Quote: ... and loaded onto Biosprint 15 (Qiagen). Proteins were washed two times with 750 μl of buffer A (or AG ...
-
bioRxiv - Cell Biology 2024Quote: ... 15 uL proteinase K (Qiagen 19131) was added to each sample ...
-
bioRxiv - Genomics 2022Quote: ... as described previously.(17) The amplified library was purified using a PCR Cleanup Kit (Qiagen #28104) and size selected for 150-500–bp fragments on a 2% agarose gel ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Cancer Biology 2020Quote: ... diluted 1:8 in PKD buffer (Qiagen) at 56°C for 1 hour with interval shaking ...
-
bioRxiv - Molecular Biology 2024Quote: QIAcuity Nanoplate 26k 8-well (Qiagen, 250031)
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0) containing 15 mg/mL of lysozyme + 15 µL of proteinase K solution (20 mg/mL, Qiagen), and then incubated for 8–10 min ...
-
bioRxiv - Microbiology 2023Quote: ... DNA extractions were carried out using the Biosprint 15 DNA Plant Kit and Biosprint 15 robot (Qiagen, Australia) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Locked nucleic acid (LNA) probes (Qiagen) to detect either sense (5’ TYE563-labelled CCCCGGCCCCGGCCCC ...
-
bioRxiv - Immunology 2024Quote: ... RNA extraction was performed by QIAGEN Nucleic Acid Isolation Service (QIAGEN, Germany). RNA integrity number (RIN ...
-
bioRxiv - Genetics 2021Quote: ... 15 µl of Pyrosequencing Annealing Buffer (Qiagen) were mixed with 15 µl of each sample and overhangs were quantified by Pyrosequencing using the following dispensation order GTGTGTCACACATGTGTGTG (nucleotides were pipetted in a two-fold dilution ...
-
bioRxiv - Developmental Biology 2020Quote: ... with 15 min of DNase I (Qiagen) treatment.
-
bioRxiv - Evolutionary Biology 2023Quote: ... each of 15 μL of EB (Qiagen) buffer incubated at 37 C for 10 minutes.