Labshake search
Citations for Qiagen :
401 - 450 of 1357 citations for 2x SYBR Green qPCR Master Mix Low ROX since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was processed for real time q-PCR using SYBR-green (QuantiFast SYBR Green RT-PCR Kit, Qiagen) and determination of ΔΔCT-values was done on the CFX Maestro Software (Bio-Rad Laboratories) ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated as previously described.8 The cDNA and purified viral DNA were used for quantitative PCR (qPCR) using QuantiTect probe PCR master mix (Qiagen) and optimized concentrations of forward primer (TGTGTGGGAGACCATCAAGC) ...
-
bioRxiv - Cancer Biology 2021Quote: ... using QuantiTect SYBR green PCR Kit (Qiagen) or miScript SYBR Green PCR Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... QuantiTect SYBR Green PCR Kit (204143, Qiagen) and BioRad C1000 (base ...
-
bioRxiv - Microbiology 2020Quote: ... the Quantitect SYBR Green PCR kit (Qiagen) was used on the QuantStudio 6 Flex real-time PCR system (Applied Biosystems) ...
-
Epicardial slices: a 3D organotypic model for the study of epicardial activation and differentiationbioRxiv - Bioengineering 2020Quote: ... using QuantiTect SYBR Green PCR Kit (Qiagen) and the primers in Table 1 and results were normalized to the house-keeping gene β-2 microglobulin (B2M).
-
bioRxiv - Neuroscience 2021Quote: ... with QuantiFast SYBR Green PCR Kit (Qiagen) or Taqman Assay (Thermo Fisher ...
-
miR-206 inhibits estrogen-induced proliferation and invasion of ER-α36 positive gastric cancer cellsbioRxiv - Cancer Biology 2021Quote: ... miScript SYBR Green PCR Kit (Qiagen, Inc.) was used to perform qPCR with ABI 7500 PCR Amplifier (Applied Biosystems ...
-
bioRxiv - Physiology 2020Quote: ... using QuantiNova SYBR Green PCR Kit (QIAGEN); 10 ng of cDNA per reaction was used in a total volume of 10 μl PCR reaction mixture ...
-
bioRxiv - Systems Biology 2021Quote: ... using QuantitTect SYBR Green PCR kit (Qiagen). Amplification was normalized to GAPDH ...
-
bioRxiv - Neuroscience 2022Quote: ... using the Quantitec SYBR Green kit (Qiagen). Gene expression was normalized to HMBS or B2M levels within each sample ...
-
bioRxiv - Microbiology 2022Quote: ... or QuantiNova SYBR Green PCR Kit (Qiagen) with PCR conditions as described below ...
-
bioRxiv - Immunology 2022Quote: ... using pre-designed SYBR Green Primers (QIAGEN) specific for Ifit2 (PPM05993A) ...
-
bioRxiv - Neuroscience 2023Quote: ... the SYBR Green PCR kit (Qiagen, #208052) and oligonucleotide primers (Eurogentec ...
-
bioRxiv - Microbiology 2022Quote: ... One-step RT-qPCR was performed with QuantiFast Probe RT-PCR+ROX Vial Kit (Qiagen) on the Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cDNA libraries were then diluted 80 times and used for the analysis of gene expression by qPCR using miRCURY LNA SYBR Green PCR kit (QIAGEN, 339347) with miRCURY LNA™ primers (YP00203907 for U6 ...
-
bioRxiv - Plant Biology 2020Quote: ... RT-qPCR was performed in an Applied Biosystems QuantStudio 3 thermocycler using the QuantiNova Probe SYBR Green PCR Kit (Qiagen, Germany); mix proportions and cycling parameters were used as described in manufacturer’s instructions ...
-
bioRxiv - Pathology 2021Quote: ... innate and adaptive immunity and energy metabolisms were determined by quantitative polymerase chain reaction (qPCR) using QuantiTect SYBR Green PCR Kit (Qiagen, Netherlands) on the LightCycler 480 system (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... dsDNA binding dye (SYBR® green) chemistry-based qPCRs were performed on purified RNA samples using Rat GABA & Glutamate RT2 Profiler PCR arrays (Qiagen, Inc. ...
-
bioRxiv - Physiology 2023Quote: ... A one-step real-time quantitative polymerase chain reaction (RT-qPCR) was performed using a QuantiFast SYBR Green RT-PCR one-step kit on a Rotorgene 3000Q thermocycler (Qiagen, UK). Each reaction was setup as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... The cDNA thus obtained was diluted to 2 ng/µl and specific target miRNAs were amplified by qPCR using the miRCURY LNA SYBR Green PCR kit (Qiagen, 339346). Expression of all targets was normalised against the expression of two reference genes (SNORD48 and U6 ...
-
bioRxiv - Plant Biology 2019Quote: ... All qRT-PCR reactions were performed using SYBR Green I (QuantiFast® SYBR® Green PCR Kit, Qiagen, Germany) chemistry and ARF (ADP-Ribosylation Factor ...
-
bioRxiv - Plant Biology 2021Quote: ... Reactions were carried out in 15 μL total reaction volume: 7.5 μL of SYBR-green (QuantiFast SYBR Green PCR Kit - Qiagen), 0.3 μL of forward and reverse gene-specific primers ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 10 μl of HotStarTaq Master Mix (Qiagen), 0.08 μM of each primer ...
-
bioRxiv - Microbiology 2020Quote: ... 1× Qiagen Multiplex Master Mix (QIAGEN, Germany) and 5 μL of template DNA in a 15 μL reaction ...
-
bioRxiv - Microbiology 2019Quote: ... 25 μl of TopTaq master mix (Qiagen), 0.5 μl of each forward and reverse bar-coded primer (57) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Taq PCR Master Mix (Qiagen; catalogue #201443) and Taqman Assay-on-Demand primer/probe sets (Thermo Fischer Scientific ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 μl Type-it Master Mix (Qiagen), 0.17 μM of either FAM or VIC ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... containing 1 × Master Mix (Qiagen Multiplex Kit), 0.4 μg/μL of BSA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... reverse transcription and amplification of the S gene were done with the one-step QuantiFast Sybr Green RT-PCR mix (Qiagen) as follows ...
-
bioRxiv - Developmental Biology 2021Quote: ... The relative expression levels of the mRNA of interest were determined by real-time PCR using Quantifast SYBR Green Mix (Qiagen) with specific primers listed in Supplementary Table 1 and a LightCycler 480 (Roche) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... reverse transcription and amplification of the S gene were performed using the one-step QuantiFast Sybr Green RT-PCR mix (Qiagen) as follows ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR reactions were performed using the miRCURY LNA SYBR Green PCR Kit and the following locked nucleic acid (LNA) SYBR green primers from Qiagen: mmu-miR-598-3p ...
-
bioRxiv - Plant Biology 2020Quote: ... The resulting cDNA was quantified by qPCR using the MAXIMA SYBR green kit with 40 cycles in a Rotor-gene Q thermocycler (Qiagen Venlo, Netherlands), following the settings ...
-
bioRxiv - Pathology 2020Quote: ... The cDNA was first diluted with nuclease-free water and then added to the RT2 SYBR Green ROXTM qPCR Mastermix (Qiagen, Hilden, Germany) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 ng of each sample was used per reverse transcription-quantitative polymerase chain reaction (RT-qPCR) reaction using the QuantiTect SYBR® Green RT-PCR Kit (Qiagen, 204243) on Rotor-Gene Q (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time RT-PCR reactions were then performed to determine the mRNA levels of target genes using RT2 SYBR Green Fluor qPCR Mastermix (Qiagen, Limburg, Netherlands) on a CFX Connect Real Time PCR System (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... using the Quantitect SYBR Green PCR kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... employing the QuantiTect SYBR Green PCR Kit (Qiagen). Each sample was analyzed in triplicates for transcript levels - given as cycle threshold (Ct ...
-
bioRxiv - Biochemistry 2020Quote: ... using the QuantiFast SyBr Green PCR Kit (Qiagen) and the following primers ...
-
bioRxiv - Molecular Biology 2020Quote: The Qiagen SYBR Green PCR kit (Qiagen, Germany) was used for real-time PCR ...
-
bioRxiv - Biochemistry 2019Quote: ... with the QuantiNova SYBR Green PCR Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... using the RT2 SYBR Green Mastermix (Qiagen, UK). The relative mRNA level of the target gene was calculated using CFX Manager Software (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... and the QuantiTect SYBR Green PCR Kit (Qiagen). Sequences of the different primer pairs used for PCR amplification of mouse and rat TPH2 and SERT cDNAs are listed in Supplementary Table S1.
-
Biallelic loss-of-function OBSCN variants predispose individuals to severe, recurrent rhabdomyolysisbioRxiv - Genetics 2021Quote: ... The Rotor-Gene SYBR Green PCR Kit (Qiagen) was used to set up 10 μL reactions containing 1 μL diluted cDNA and 0.8 μM each of forward and reverse primers (OBSCN ...
-
bioRxiv - Plant Biology 2021Quote: ... and QuantiTect SYBR® Green PCR Kits (Qiagen). Gene-specific primers were designed using Primer3 and blast was carried out using NCBI BLAST to determine any miss-priming (Table S1) ...
-
bioRxiv - Neuroscience 2021Quote: ... and LNA SYBR green PCR kit (Qiagen, 339345). Relative-fold changes were normalized comparing exosomal micro RNA reference gene miR-30c-5p using the primer hsa-miR-30c-5p miRCURY LNA miRNA PCR Assay (Qiagen 339306 ...
-
bioRxiv - Microbiology 2021Quote: ... using the QuantiTect Sybr Green PCR kit (Qiagen). PCR conditions were 10 min at 90°C and 40 cycles of 15 s at 95°C and 1 min at 60°C ...
-
bioRxiv - Microbiology 2022Quote: ... QuantiFast SYBR Green RT-PCR Kit (Qiagen, 204156) was used for the qPCR reaction and measurement performed on the 7500 Fast Real-Time PCR System (Applied Biosystems) ...