Labshake search
Citations for Qiagen :
1 - 50 of 1774 citations for 2 Triisopropylsilyl Oxazole 5 Carbaldehyde since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Pathology 2022Quote: ... with stainless steel beads (2×5 mm) using a TissueLyser (Qiagen, Germantown, MD) for three minutes at 25 r/s twice ...
-
bioRxiv - Microbiology 2020Quote: ... with 2 × 5 mm stainless steel beads using the TissueLyser (Qiagen, Hilden, Germany) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 2–5 min with steel balls in a tissue lyser (Qiagen, Germany). Tissue lysates were incubated with the buffer at 4°C overnight (cell samples were incubated in lysis buffer for 30 min at 4°C) ...
-
bioRxiv - Biochemistry 2024Quote: ... incubated 2 hr with 5 mL of packed Ni-NTA agarose beads (Qiagen), filtered (0.45 µm Millex-HP PES membrane filter unit ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 2 hours after which samples were treated with 5 μL Proteinase K (Qiagen 19131) overnight ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 (2×106 cells/well) using the RNeasy Mini Kit (Qiagen) with DNase I treatment to eliminate DNA contaminants as previously described18 ...
-
bioRxiv - Microbiology 2023Quote: Cellular RNA of 2-5×105 cells was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 h time points were immediately mixed with 2 x volume of RNAProtect® (Qiagen) using the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNAs used were RAPH1 siRNA #2 (Hs_RAPH1_2, SI00698642) and RAPH1 siRNA #5 (Hs_RAPH1_5, SI04300982) provided by Qiagen.
-
bioRxiv - Cancer Biology 2023Quote: Each qPCR reaction consisted of 5 μL of 2× QuantiNOVA SYBR Green PCR master mix (Qiagen), 0.5 μL of 10 μM forward and reverse primers each ...
-
bioRxiv - Cell Biology 2020Quote: ... His6-SUMO-WASHC2C-5-SNAP was purified using lysis buffer #2 and Ni-NTA-agarose beads (Qiagen). The protein was incubated with Ni-NTA beads and washed with 50 mM imidazole ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and homogenized twice at 10 s at 2 M/s with a 5-mm steal bead (Qiagen) using a tissue homogenizer (MP Biomedicals) ...
-
bioRxiv - Genomics 2024Quote: RNA was extracted from 2-5 million flash frozen cells using the RNeasy plus mini kit (Qiagen). Libraries were prepared using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (New Englands Biolabs) ...
-
bioRxiv - Bioengineering 2024Quote: ... lysis buffer and homogenized at 1000 rpm for 2 min with 5 mm Stainless Steel Beads (Qiagen) using 1600 MiniG Tissue Homogenizer (SPEX SamplePrep) ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 200 ng psiCHECK-2 reporter plasmid were co-transfected with 5 µl miScript miRNA mimics (Qiagen; CatNo. 219600) using 4 µl Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of cDNA was then added to a PCR mix containing 12.5 μl 2× Multiplex PCR mix (Qiagen), 9 μl H2O ...
-
bioRxiv - Genomics 2023Quote: MII oocytes and 2-cell embryos were individually lysed and flash-frozen in 5 μl RLT Plus buffer (Qiagen) and stored at −80°C until further use ...
-
bioRxiv - Physiology 2024Quote: Frozen tissue was transferred into pre-chilled 2 ml microfuge tubes containing two 5 mm stainless steel beads (Qiagen) and 5 volumes of ice-cold buffer (10 mM HEPES buffer pH 7.5 ...
-
bioRxiv - Genetics 2020Quote: ... in a 2 ml Eppendorf (Hamburg, Germany) tube using Stainless Steel Beads (5 mm) and the TissueLyzer (QIAGEN, Venlo, Netherlands). After an incubation time of 5 min ...
-
bioRxiv - Microbiology 2020Quote: ... Purified extracellular WT and Δtgif2k-b tachyzoites were treated with vehicle or 5 μM sodium arsenite for 2 h at 37°C and total RNA was extracted using RNeasy (Qiagen). The RNA concentration for each sample was measured using Nanodrop One (Thermo Scientific) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... ∼2.5×108 cells (0.5 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Microbiology 2022Quote: L cell monolayers were disrupted by scraping and pelleted at 200 x g for 5 min before RNA was isolated from 2 x 105 cells using the RNeasy Plus Mini RNA extraction kit (Qiagen) per manufacturer’s protocol.
-
bioRxiv - Microbiology 2022Quote: ... of 0.2-0.3 was pelleted by centrifugation at 7000 x g for 5 minutes and pellets were resuspended in 1mL of ATGN media and incubated with 2 mL of RNAProtect reagent (QIAgen) for 15 min at room temperature ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Microbiology 2021Quote: ... up to 200 mg of tissue was disrupted in TRIzol (Lifetechnologies) with 2 x 5 mm stainless steel beads using the TissueLyser (Qiagen) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Microbiology 2020Quote: ... up to 200 mg of tissue was disrupted in TRIzol (Lifetechnologies) with 2 x 5 mm stainless steel beads using the TissueLyser (Qiagen) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA and proteins were extracted from fresh or snap-frozen FACS-sorted 2-5 million splenic B cells using AllPrep DNA/RNA/Protein Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mosquito bodies and legs were homogenized in phosphate-buffered saline (PBS) supplemented with 20% FBS and 2% penicillin-streptomycin with 5-mm stainless steel beads with a TissueLyser (Qiagen) before RNA isolation ...
-
bioRxiv - Immunology 2024Quote: ... slides from 25 epidemic KS and 2 endemic KS tumor biopsies and 5 samples of uninvolved skin using the AllPrep DNA/RNA FFPE Kit (QIAGEN). Gene expression analysis was performed on RNA samples on the Nanostring platform (Nanostring Technologies ...
-
bioRxiv - Plant Biology 2024Quote: ... The fresh leaf discs were transferred to a 2 mL tube containing a 5 mm stainless steel bead and 500 µL buffer RLT (QIAGEN). The leaf discs were disrupted using a TissueLyser LT (QIAGEN ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Approximately 50 mg of tissue was homogenised in 500 µl phosphate-buffered saline (PBS) for 2 min at 30 Hz using 5 mm steel beads on a TissueLyser II instrument (Qiagen). Total nucleic acids were extracted using the Nucleo Mag Vet Kit (Macherey & Nagel ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was extracted from 2 mm root tips of 5 DAG seedlings using the RNeasy Plus Micro Kit (cat. No. 74034 QIAGEN). Prior to cDNA synthesis ...
-
bioRxiv - Biochemistry 2022Quote: Approximately 25 mg of frozen tissues were transferred to 2 mL Eppendorf Protein Lobind tubes containing one 5 mm stainless steel bead (cat# 69989, Qiagen) and 500 µL of lysis buffer consisting of 5% SDS in 50 mM TEAB with protease inhibitors cocktail (cat# A32953 ...
-
bioRxiv - Physiology 2024Quote: ... was mechanically homogenised in TRI reagent with a 5 mm steel bead at 30 Hz for 2 x 30 s (TissueLyser II, Qiagen) then centrifuged for 10 min at 10,000 g ...
-
bioRxiv - Synthetic Biology 2024Quote: ... two small lab spoons (5 mm) of biomass were transferred to a 2 mL screw cap tube with a steel bead inside (5 mm; Qiagen) and frozen using liquid nitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... Eluted complex was then mixed to 6 μL of 5 M NaCl and 2 μL of 100 mg/mL RNase A (Qiagen) and incubated overnight at 65°C to reverse cross-linking and digest RNA ...
-
bioRxiv - Genomics 2022Quote: The second lobe of lung or trachea was immersed in 1 mL PBS in a 2 mL Micro Centrifuge Tube (Fisherbrand, 14-666-315) containing one stainless steel bead (5 mm, QIAGEN, 1026563) immediately after dissecting the SARS-CoV-2 infected mouse or hamster ...
-
bioRxiv - Microbiology 2020Quote: ... and then with (2) 15 µl Proteinase K [>600 mA/ml] and 5 µl Rnase A [100 mg/ml] (Qiagen, Germany) for 5min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Bioengineering 2024Quote: ... posterior eye cups (PECs) were separated and collected in 2 mL reinforced tubes (SPEX Sample Prep) containing 5 mM stainless steel beads (Qiagen, LLC).