Labshake search
Citations for Qiagen :
1 - 50 of 3862 citations for 2' Chloro 4 5 5 dimethyl 1 3 dioxan 2 yl butyrophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cell Biology 2022Quote: ... oligo #2 (Q2) 5’-CCCGAAATATTTAGGCCTGAA-3’ (Qiagen, SI00758415) and oligo 5 (Q4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’-ATGATCGATCATCTATAGCAA-3’ and 25nM S1PR1 #2 (Qiagen, #SI00376208) 5’-TAGCATTGTCAAGCTCCTAAA-3’ siRNAs or AllStars Negative Control siRNA (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-TGGTTCTACATCAGAGTTGTT-3’ (Qiagen). Lentiviral particles expressing SMART vectors doxycyclin-inducible shRNA were from Dharmacon as follows ...
-
bioRxiv - Cell Biology 2022Quote: ... and oligo 5 (Q4) 5’-CACCGAGCTCTTCGCCGAGTA-3’ (Qiagen, SI03058272).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Neuroscience 2024Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Cell Biology 2022Quote: ... ONTARGETplus Non-targeting siRNA oligo#1 (NT1) 5’-TGGTTTACATGTCGACTAA-3’ (Dharmacon, D-001810-01) and FlexiTube siRNA h USP31 oligo #1 (Q1) 5’-CCGAGTTCATGAAGACCTCAA-3’ (Qiagen, SI00758422), oligo #2 (Q2 ...
-
bioRxiv - Microbiology 2021Quote: ... NG1 (5’ACCGACCACAGGGGG-3’) and NG2 (5’-GGTTGTAAACCTCTTTCGA-3’) and HotStarTaq® Master Mix Kit (Qiagen) up to a final volume of 25 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’, Qiagen), si-uS19 (5’-UCACCUACAAGCCCGUAAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-eS4X (5’-CUGGAGGUGCUAACCUAGGAA-3’, Qiagen), si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Pathology 2022Quote: ... with stainless steel beads (2×5 mm) using a TissueLyser (Qiagen, Germantown, MD) for three minutes at 25 r/s twice ...
-
bioRxiv - Microbiology 2020Quote: ... with 2 × 5 mm stainless steel beads using the TissueLyser (Qiagen, Hilden, Germany) for 3 minutes at 25 r/s twice ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 2–5 min with steel balls in a tissue lyser (Qiagen, Germany). Tissue lysates were incubated with the buffer at 4°C overnight (cell samples were incubated in lysis buffer for 30 min at 4°C) ...
-
bioRxiv - Biochemistry 2024Quote: ... incubated 2 hr with 5 mL of packed Ni-NTA agarose beads (Qiagen), filtered (0.45 µm Millex-HP PES membrane filter unit ...
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Genomics 2024Quote: ... 1 µL (50U) of high-concentration klenow 3’-5’ exo-polymerase (Qiagen) was added ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Pathology 2022Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Pathology 2023Quote: ... with 2 x 5 mm stainless steel beads using a TissueLyser (Qiagen, Germantown, MD) for 3 minutes at 25 r/s for 2 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotides containing shRNA inserts were PCR-amplified with primers 5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’ and 5’-TGAACTCGAGAAGGTATATTGCTGTTGACAGTGAGCG-3’ and purified with QIAquick PCR Purification Kit (Qiagen). shRNA inserts and miRE18_LT3GEPIR_Ren714 backbone (inducible via Tet-On system ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was obtained and amplified in a first-round PCR (RdRpS1 5’-GGKTGGGAYTAYCCKAARTG-3’, RdRpR1 5’-TGYTGTSWRCARAAYTCRTG-3’) using One-Step RT-PCR Enzyme MixKit (Qiagen) with the total expected size of 602 base pairs (bp) ...
-
bioRxiv - Cell Biology 2024Quote: ... target sequence 5’-TTGCTTGGAGGCTACTCCCAA-3’) and control non-silencing scrambled siRNA (siSCR, target sequence 5’-AATTCTCCGAACGTGTCACGT-3’) were obtained from Qiagen. MAPK15-specific siRNA #2 (siMAPK15 #2 ...
-
bioRxiv - Physiology 2023Quote: ... Arf6 siRNA sequence: 5’- CAACGTGGAGACGGTGACTTA-3’ (QIAGEN SI02757286). QIAGEN All Stars Negative sequence was used as control.
-
bioRxiv - Cell Biology 2023Quote: ... and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299, Qiagen).
-
bioRxiv - Cell Biology 2023Quote: ... β-actin as housekeeping gene (Forward: 5’-CAGCCATGTACGTTGCTATCCAGG-3; reverse: 5’-AGGTCCAGACGCAGGATGGCA-3’) and 2X RT2 SYBR Green qPCR master mix (Qiagen, UK). The relative fold change in gene expression was analysed using the double delta Cq analysis (2-ΔΔCq ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ~5×108 cells (1 ml of OD600 0.5) were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, Hilden, Germany) and pelleted ...
-
bioRxiv - Genetics 2023Quote: ... To prepare the protein column we loaded 2 mL (1 mL column volume) of Nickel NTA resin onto the 5 mL Polypropylene columns from Qiagen and the resin buffer was allowed to drain ...