Labshake search
Citations for Qiagen :
1 - 50 of 3161 citations for 1 1' 3' 1'' Terphenyl 4 4'' dimethanamine 5' 4 aminomethyl phenyl 9CI since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Genomics 2023Quote: Approximately 3-4 million cells were solubilized with 1 mL QIAzol (Qiagen, 79306) and 0.2 mL chloroform in 5PRIME Phase-Lock Gel heavy tubes (QuantaBio ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA) ...
-
bioRxiv - Immunology 2023Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen): cDNA ...
-
bioRxiv - Immunology 2020Quote: ... Samples were diluted at 4:1 (elution buffer (Qiagen)/cDNA ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 min, 4°C) prior to incubation (1 h, 4°C) with 4.0 mL of Ni-NTA agarose (Qiagen) pre-equilibrated in the same buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extract was cleared by centrifugation at 186,000g for 1 hour at 4 °C and then incubated at 4 °C with NiNTA resin (QIAGEN) for 4 h ...
-
bioRxiv - Biochemistry 2024Quote: ... the suspension was diluted 4 times and incubated for 1 hour at 4°C with 200 µL of Ni-NTA agarose (Qiagen) preequilibrated in the lysis buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 1 h and purified by affinity chromatography using a 5 ml Ni-HP column (Qiagen). Flow through with pure AstaPo1 was collected and dialyzed overnight against the buffer containing 50 mM Tris pH 7.6 ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Immunology 2021Quote: ... 3-4 pieces were placed into RNAlater (Qiagen) for gene expression analysis ...
-
bioRxiv - Immunology 2022Quote: ... After diluting samples in a 4:1 ratio (elution buffer [Qiagen]:cDNA), cDNA concentration was determined using a Bioanalyzer (Agilent Technologies).
-
bioRxiv - Molecular Biology 2022Quote: ... HL-1 cells were transduced with a pool of 4 gapmers (Qiagen) at 40nM (10Nm each ...
-
bioRxiv - Biochemistry 2024Quote: ... The remaining supernatant was centrifuged again at 5,000 x g for 20 minutes at 4°C and equilibrated for 1 hour in 3 mL of Ni-NTA resin (Qiagen) that was pre-equilibrated in the extraction buffer ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 °C) and the supernatant was then loaded onto 1 ml HisTrap HP column (Qiagen) at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... the supernatant was incubated for 1 hour at 4°C with Ni-NTA-agarose (Qiagen), washed several times with lysis buffer and the protein was eluted by incubation for 3 hours with lysis buffer containing 500 mM imidazol ...
-
bioRxiv - Genomics 2023Quote: ... Button valves were opened and biotinylated anti-pentaHis antibody (Qiagen, 1:4 dilution in HEPES) was flowed for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... Medium was stirred for 1 hour at 4°C in the presence of 5 ml Ni-NTA Agarose beads (Qiagen, Venlo, The Netherlands) washed with 25 mM Hepes-KOH pH 7.5 ...
-
bioRxiv - Bioengineering 2020Quote: ... Each well is then diluted with 1 to 4 v:v in RNAse free elution buffer (QIAgen) to a total volume of 8 µL ...
-
bioRxiv - Molecular Biology 2023Quote: ... An A base was added to the 3’ ends with Klenow (3’-4’ exo-) (Qiagen). The processed ds-cDNA was then ligated to Illumina sequencing adapters with T4 DNA Ligase (Qiagen) ...
-
bioRxiv - Systems Biology 2022Quote: ... Ten millilitres of culture were pelleted by immediate centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Neuroscience 2024Quote: ... using a TissueLyser (2 × 30 Hz, 3 min at 4°C; QIAGEN). After homogenization ...
-
bioRxiv - Cell Biology 2023Quote: ... and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Microbiology 2020Quote: ... The soluble fraction was incubated for 1 hour at 4 °C using a Ni-NTA resin (Qiagen). The Ni-NTA resin was washed with 4 times resin volume (RV ...
-
bioRxiv - Genomics 2022Quote: ... and homogenized at 25/s for 1 min at 4°C using a TissueLyser II (Qiagen, 85300). Samples were incubated at room temperature for 5 min followed by addition of 180 μl chloroform ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 μL of cDNA was added to 1 μL of pre-purchased primers (QuantiTect primers (Qiagen, Germany)) and qPCR was carried using the StepOnePlus machine (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... RT buffer 5x (4 μL) RT primer mix and Reverse transcriptase (1 μL) (Qiagen, Cat. No. 205311) added in a final volume of 20 μL ...
-
bioRxiv - Physiology 2024Quote: ... CST-KO (4) and CST-KO+CST mice (4) using RNeasy kit (Qiagen). RNA was quantified using Nanodrop spectrophotometer (Thermo ScientificTM) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tissues were weighed and homogenized in 4 volumes of water (4 µL of water/mg tissue, 4°C) using a bead beater (TissueLyser II, QIAGEN; Germantown, MD). Aqueous homogenates were profiled using four complimentary liquid chromatography tandem mass spectrometry (LC-MS ...
-
bioRxiv - Developmental Biology 2021Quote: ... E18.5 RNA was extracted from cortices of 3 genotypic conditional knockouts and 4 controls using the RNeasy Micro Kit (Qiagen). RNA was reverse transcribed to cDNA using the SuperScript™ II Reverse Transcriptase Kit (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... containing Protease inhibitor cocktail (PIC, Complete, 1:25) and lysed at 4°C using a TissueLyser LT (Qiagen) on 50 Hz for 2 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% CA630) and rotated at 4°C for 2 hours before addition of His-beads (Ni-NTA, QIAGEN). After continuous rotating for another 2 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Effectene (4 μL of enhancer and 5 μL of Effectene reagent; Qiagen 301427) was used to transfect 500 ng of the indicated eGFP plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... pools of 3 x 103 MPP1-4 were sorted directly into RLT buffer (Qiagen) enriched with 1% of β-mercaptoethanol ...
-
bioRxiv - Physiology 2021Quote: ... 10-50 mg tissue was homogenized (1 mM EDTA and 4 mM sodiummetabisulfite, pH 7.4) using a TissueLyser II (Qiagen). Samples where adjusted to the same weight/volume percentage by adding a volume of homogenization buffer and the NA content was measured by ELISA (BA E-5200 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was isolated at 6 time points (0, 0.5, 1, 2, 4, and 8 hours) using the RNeasy Mini kit (Qiagen) according to the manufacturer’s recommended protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 30 min at 45,000 × g at 4°C and incubated with 1 ml of Ni-NTA agarose beads (Qiagen) per 1 l of expression culture for 2 h rotating at 4°C ...