Labshake search
Citations for Qiagen :
401 - 450 of 2235 citations for R 4 Benzyl 2 2 diphenylphosphino benzyl 4 5 dihydrooxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix, 5μL of QIAGEN 5x Q-solution and 2 μL of primer mix). A positive control reaction ...
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Generation of cDNA was performed by GoTaq 2-step RT system (Qiagen). Real-time PCR reactions were measured by ABI StepOnePlus system using SYBR green qPCR master mix (ThermoFisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2-mercaptoethanol and purified using the RNeasy Micro kit (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... 6xHis-tagged CDK-2 was purified using Ni-NTA resins (Qiagen 30210) and eluted in PBS ...
-
bioRxiv - Plant Biology 2021Quote: ... nks1-1 and nks1-2 using RNeasy Plant mini kit (74904, QIAGEN). cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691 ...
-
bioRxiv - Microbiology 2020Quote: ... except that 2 mL prefilled bead tubes (Qiagen; catalog no., 13118-50) were used for the bead beating ...
-
bioRxiv - Microbiology 2022Quote: ... (2) PCR purification was conducted using the QIAquick PCR Purification Kit (Qiagen), and (3 ...
-
bioRxiv - Neuroscience 2020Quote: Primary microglia or BV-2 cells were collected in RLT buffer (QIAGEN). RNA was isolated using RNEasy Micro or Mini Kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2 μl of 10 mg/ml RNase (Qiagen Valencia, CA, USA) was added to each of the samples and kept at 4°C for 30 minutes to remove fragments of RNA strands.
-
bioRxiv - Genetics 2020Quote: ... rad54-1 and rad54-2 plants using RNeasy Plant mini Kit (QIAGEN), following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... crushed at 50Hz for 2 minutes with a TissueLyser (Qiagen, ref 85600) and centrifuged at 10000g for 5 minutes at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... The samples then had a 2:1 ratio of RNAprotect (Qiagen: #76506) added to them and centrifuged at 5,000 RCF for 10 min ...
-
bioRxiv - Genomics 2021Quote: ... and a 2% agarose gel using the QIAquick gel extraction kit (Qiagen). In a second PCR ...
-
bioRxiv - Genomics 2021Quote: SARS-CoV-2 RNA was extracted with QIAamp Viral Mini Kit (Qiagen) in a QIACube extractor or with Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... Plant material was then homogenised for 2 min in a tissuelyser (Qiagen) using adaptors kept at −70 °C ...
-
bioRxiv - Physiology 2022Quote: ... with 2 cycles in a Bead Beater TissueLyser II (Qiagen, Germantown, MD) at 24 Hz for 2 min each ...
-
bioRxiv - Biophysics 2022Quote: ... combined with Ni-NTA resin (2 mL/1 L of biomass, Qiagen) pre-equilibrated with 40 mM sodium phosphate buffer ...
-
bioRxiv - Microbiology 2024Quote: ... or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0, Qiagen). Then ...
-
bioRxiv - Immunology 2024Quote: ... 2 × QuantiFast SYBR Green PCR Master Mix kit (QiaGen, Cat No. 204056) was used following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... for DNA extraction and (2) RNeasy Mini Kit (Qiagen, cat. no. 74104) for RNA.
-
bioRxiv - Microbiology 2023Quote: ... each treated culture was mixed 1:2 with RNA Protect (Qiagen, Germany), vortexed for 10 seconds ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples (2 larvae per tube) were homogenized in a TissueLyser-LT (Qiagen) in 200 μl of the corresponding buffer according to the assay ...
-
bioRxiv - Biochemistry 2022Quote: ... The column was prepared with 2 mL Ni-NTA Agarose Resin (Qiagen). The resin was equilibrated with 10 column volumes of column buffer and resuspended with the supernatant cell extract for 1 h at 4°C with orbital shaking ...
-
bioRxiv - Neuroscience 2024Quote: ... SK-N-BE(2) cells and iNeurons with an RNeasy kit (Qiagen) using the manufacturer’s protocol including homogenization of samples with QIAshredder spin columns (Qiagen) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes (1 mL) of RNA protection bacteria reagent (Qiagen, Hilden, Germany) were added ...
-
bioRxiv - Microbiology 2024Quote: ... Cultures were combined with 2 volumes of RNAprotect® (Qiagen, Manchester, UK) and incubated for 5 mins at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... 2 and 6 weeks post-SIV using the miRNeasy Mini Kit (QIAGEN). RNA was isolated from 1-2 x 106 PBMC resuspended in 700 µl QIAzol collected at week 7/Day -14 pre-ZIKV inoculation ...
-
bioRxiv - Biophysics 2024Quote: ... samples were transferred to 2 mL maXtract high density tubes (Qiagen, 129056) and 200 uL of chloroform was added ...
-
Loss of PKCθ-GADD45a axis drives triple-negative breast cancer cells into p53-independent senescencebioRxiv - Cancer Biology 2024Quote: RT2 Profiler PCR Arrays Human Cellular Senescence (PAHS-050ZD-2) from Qiagen were used to identify the gene expression profiles of MDA-MB-436 cells expressing siCtrl or siPKCθ-1 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 4 mL of culture using the miRNAeasy Mini Kit (Qiagen, Hilden, Germany) and Qiazol lysis reagent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: ... 6b and 6d and the Supplemental Figure 4 we used the RNAeasy Minikit (Qiagen; Cat#74104) following the manufacturer’s instruction.
-
bioRxiv - Cancer Biology 2020Quote: ... then spun at 14000K RPM for 10 minutes at 4°C to pellet debris (Qiagen, 37901). Protein concentration in the supernatant was quantified using BCA assay (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... followed by addition of 4 μg pBABE-hygro-hTERT prepared by maxiprep (Qiagen Canada, Mississauga, ON), to a final volume of 200 μl ...
-
bioRxiv - Genetics 2022Quote: ... Midi, 3-4 ml of blood) and Puregene (0.3-1 ml of blood, manual extraction) (Qiagen, Cat# 1057048 ...
-
bioRxiv - Bioengineering 2020Quote: ... Each well is then diluted with 1 to 4 v:v in RNAse free elution buffer (QIAgen) to a total volume of 8 µL ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) and supernatant was transferred to tubes containing 30µl precleared Ni-NTA agarose beads (Qiagen) in the presence of 0.05% Tween-20 and 15mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: ... the rest of the embryo was fixed in 4% paraformaldehyde/PBS and stained with DAPI (Qiagen) for easy visualization of the somites under a microscope and characterization of the embryonic stage ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The concentration of purified RNA was measured using a Qubit 4 fluorometer (QIAGEN K.K., Tokyo, Japan) with Qubit RNA BR Assay kits (QIAGEN K.K. ...
-
bioRxiv - Microbiology 2020Quote: ... Cell pellets were recovered (5000g, 15 min at 4 0C) and lysed in QIAzol reagent (Qiagen). Total RNA was isolated using the RNeasy mini kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Further these lysates were incubated overnight at 4°C with prewashed Ni-NTA beads (Qiagen, 30210).Sequential washes with wash buffer 1-4 ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...