Labshake search
Citations for Qiagen :
401 - 450 of 723 citations for Phosphatidylinositol N acetylglucosaminyltransferase subunit Q PIGQ Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The affitin detection was carried out using the RGS-His6-HRP conjugate (QIAGEN).
-
bioRxiv - Microbiology 2021Quote: ... a penta-His HRP conjugate was used (1:4000, QIAGEN GmbH, Hilden, Germany). The detection of GFP was performed with the primary antibody anti-GFP (1:10000 ...
-
bioRxiv - Plant Biology 2020Quote: ... QPCRs were run using the recommended protocol for 2x ProPlant SYBR Mix (Procomcure Biotech) on a Rotor-Gene Q (Qiagen). Technical triplicates were performed for each biological replicate ...
-
bioRxiv - Genetics 2020Quote: ... Analyses of HTT CAG repeat size in both HttQ111 mice and in patient fibroblasts was performed by PCR using human-specific HTT primers and Taq PCR Core Kit with Q solution (Qiagen), as previously described (17 ...
-
bioRxiv - Microbiology 2021Quote: ... 1 g yeast extract in 750 ml of 30 kDa filtered seawater and 250 ml of Milli-Q water) using the DNeasy Blood & Tissue kit (Qiagen) following the manufacturer’s recommendations ...
-
Dimeric prion protein ligand activates Adgrg6 but does not rescue myelinopathy of PrP-deficient micebioRxiv - Neuroscience 2020Quote: ... The temperature was increased from 25 °C to 95 °C at 3 °C per minute and fluorescence was measured at 610 nm in a Rotor-Gene Q thermocycler (Qiagen). The experiment was performed in technical triplicates ...
-
bioRxiv - Microbiology 2020Quote: ... and the cycle-threshold CT translated to bacterial load (estimated CFU per mL (eCFU/mL) using a standard curve on a Rotor gene Q 5plex platform (Qiagen). The cut-off for TB-MBLA positivity is a 30 CT value that corresponds to 1.0 log10 eCFU/mL ...
-
Biallelic loss-of-function OBSCN variants predispose individuals to severe, recurrent rhabdomyolysisbioRxiv - Genetics 2021Quote: ... Thermal cycling was performed on the Rotor-Gene Q real-time PCR cycler and data were analyzed with the associated software (Qiagen) using a cycle threshold of 0.03 ...
-
bioRxiv - Cell Biology 2020Quote: ... The real-time PCR reaction was performed with a Rotor-Gene SyBR Green on a Rotor-Gene Q cycler (Qiagen). Gene expression was calculated as copies/μL using the standard curve approach ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time qPCR reactions were run using the MESA Green qPCR MasterMix Plus for SYBR Green assay (Eurogenetec, RT-SY2X-03+WOU) on the Rotor-Gen Q device (Qiagen). Each sample was tested in triplicate ...
-
bioRxiv - Microbiology 2022Quote: ... was used for human ISG15 and ISG56 and mouse genes including Gapdh as the housekeeping gene on the Rotor-Gene Q 5plex (Qiagen). RT-qPCR primers and probes are listed in the supplementary table 2.
-
bioRxiv - Systems Biology 2022Quote: ... Real-time qPCR reactions were run using the MESA Green pPCR MasterMix Plus for SYBR Green assay (Eurogenetec, RT-SY2X-03+WOU) on the Rotor-Gen Q device (Qiagen). Each sample was tested in triplicate ...
-
bioRxiv - Microbiology 2021Quote: ... and a high resolution melt curve (HRM) in the end] using the primers listed in Table S2 on a Rotor-Gene Q instrument (Qiagen). rnpB was taken as reference for all genes ...
-
bioRxiv - Plant Biology 2021Quote: ... were set up with a CAS-1200N robotic liquid handling system (Corbett Research) and run for 50 cycles on a Rotor-Gene Q (Qiagen). Two technical replicates and three biological replicates were performed for each sample ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR triplicates of each cDNA (5 µL) were analyzed in a qPCR on a Rotor-Gene Q (Qiagen, Hilden, Germany) in a total reaction volume of 20 µL ...
-
bioRxiv - Molecular Biology 2021Quote: We performed RT-qPCR, using the AceQ qPCR SYBR Green Master Mix (Q111-03, Vazyme) on the thermocyclers Rotor-Gene Q (Qiagen) or LightCycler 96 thermal cycler Instrument (Roche Applied Science ...
-
bioRxiv - Systems Biology 2021Quote: ... Quantitative real time PCR (qRT-PCR) was performed with 1μl of the cDNA reaction using the SYBR Flash in the Rotor-Gene Q (Qiagen, USA) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl of cDNA (total volume after cDNA synthesis: 20 µl) was analyzed by quantitative PCR on a Rotorgene Q device (Qiagen) employing the QuantiTect SYBR Green PCR Kit (Qiagen) ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCR reactions were performed in triplicate with a Qiagen Rotor-Gene Q 5Plex real-time cycler (Qiagen, Germantown, MD). Transcript levels of each gene were calculated relative to that of PP2A ...
-
bioRxiv - Synthetic Biology 2022Quote: ... were set up on ice avoiding bubbles and incubated at 37 °C for about 25 min in a PCR cycler Rotor-Gene Q (Qiagen, excitation at 470 nm ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... commercially available cDNAs originating from various human tissues were purchased from TaKaRa (detailed sample information is given in Table S3) and 2 ng of cDNA were subjected to quantitative PCR (qPCR) analysis (Rotor-Gene Q, Qiagen), as recommended by the manufacturers ...
-
bioRxiv - Microbiology 2023Quote: ... and DNA was used as a template for qPCR with the PerfeCta SYBR FastMix kit (Quanta Biosciences) on a Rotor-Gene Q (Qiagen) or a 7500 PCR system (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2023Quote: ... Mitochondria isolation from HEK293T cells was performed after 24 hours of cell transfection using the Q proteome Mitochondria Isolation Kit (QIAGEN). Cell lysis and mitochondria homogenisation were conducted as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... or Taqman (qPCRBIO Probe Blue Mix Lo-ROX; PB20.25-05, qPCRBIO) and using the Rotor-Gene Q PCR system (Qiagen, Germany).
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: ... 45 cycles at 95° for 15 sec and 60° for 1 min were performed in the Rotor-Gene Q real-time PCR cycler (Qiagen). The numbers of copies of the RdRP gene in the samples were calculated using an RdRP cDNA standard curve.
-
bioRxiv - Physiology 2023Quote: ... was set within the exponential phase of the PCR using the Rotor-Gene Q Series software (v.2.3.1, Build 49, Qiagen, Hilden, Germany). The PCR product was quantified using the 2−ΔΔCt method ...
-
bioRxiv - Molecular Biology 2023Quote: ... expanded and initially screened for correct integration using homology- arm spanning PCRs (Immolase DNA polymerase, Bioline, supplemented with Q solution, Qiagen). Genotypes of positive clones were confirmed by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: All tests were run in triplicate and on a Rotor-Gene Q 2plex real time PCR Platform from QIAGEN (Germany).
-
bioRxiv - Molecular Biology 2023Quote: We performed qRT-PCR to determine the optimal number of PCR cycles for cDNA amplification to generate a sufficient amount of cDNA for library construction (cycler: Rotor-Gene-Q, Qiagen, Germany ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligonucleotides were incubated with a PCR mix containing (100 µM dNTP, 1X thermopol Taq reaction buffer, 1X of Q solution (Qiagen) and 1 µM of each primer) ...
-
bioRxiv - Molecular Biology 2024Quote: ... carried out on a QIAGEN Rotor-Gene-Q real-time PCR machine and analyzed with the Rotor-Gene 6000 series software (QIAGEN). CYCLOPHILIN (At2g29960 ...
-
bioRxiv - Genetics 2024Quote: ... The first PCR amplified from HTT to GFP (F: ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC, R: GTCCAGCTCGACCAGGATG) Taq PCR Core Kit with Q solution (Qiagen) with 5 µL of the genomic DNA with initial denaturation 95°C (5 min) ...
-
bioRxiv - Microbiology 2024Quote: ... and eubacterial 16S rRNA gene (Harms et al 2003) were quantified by qPCR in a Rotor-Gene Q 2plex (QIAGEN). qPCR reactions were performed in 10 μl final volume ...
-
bioRxiv - Immunology 2024Quote: ... TGFβ4 and the chemokine ligand CXCLi2 were measured in these tissue samples by real-time quantitative reverse-transcription PCR (qRT-PCR) using a Rotor-Gene Q version 2.3.1.49 (Qiagen, West Sussex, UK) as previously described by (Humphrey et al 2014).
-
bioRxiv - Genomics 2024Quote: ... We used the following cycling conditions for PCR amplification with the Rotor-Gene Q instrument with a 72-well rotor (QIAGEN): 95°C for 5 min ...
-
bioRxiv - Genetics 2024Quote: ... 20 µM of Illumina primers and 1:2000 dilution of 2 ng/µl library on Rotor-Gene Q machines (Qiagen), program and primer sequences are in Table) ...
-
bioRxiv - Genetics 2024Quote: ... 10 µM of primers and diluted DNA (1:50 dilution in nuclease free water) from input and immunoprecipitated (IP) fraction using Rotor-Gene Q machines (Qiagen). The qPCR program details and the primers used for qPCR validation are given below:
-
bioRxiv - Cancer Biology 2021Quote: ... After 2 hours we extracted the total RNA (RNeasy mini kit, Qiagen, cat. n. 74104) from 40 animals for each of the 3 experimental replicates (total ...
-
bioRxiv - Microbiology 2021Quote: Recombinant-construct with N-terminal His-tag was purified through IMAC-based Ni-NTA (Qiagen). IPTG induced ...
-
bioRxiv - Neuroscience 2021Quote: ... n=10) was homogenized using the PowerGen 125 handheld homogenizer in QIAzol Lysis Reagent (Qiagen) and extracted using the RNeasy Plus Universal Mini Kit (Qiagen) ...
-
bioRxiv - Biochemistry 2021Quote: ... containing an N-terminal His-tag was removed on a Ni-NTA agarose column (Qiagen). Proteins were additionally purified through a Superdex 200 26/60 size exclusion column (Pharmacia Biotech ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS ...
-
bioRxiv - Microbiology 2023Quote: ... Typhimurium strain were (n = 3) were extracted using the Rneasy kit (Qiagen Sciences, Maryland, USA), after an overnight culture in CBD tinted LB broth (for CBD-resistant strain ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular RNAs were instead extracted using an RNAeasy mini extraction kit (Qiagen, cat. n. 74004) and then treated as described above ...
-
bioRxiv - Microbiology 2024Quote: Metagenomic DNA was extracted from ectorhizosphere soils (n = 34) using the PowerSoil Pro Kit (QIAGEN) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA gene was used as internal control for normalization ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ... Real time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18 S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Biophysics 2021Quote: Thermal stability of CagFbFP and all mutated variants were measured using the Rotor-Gene Q real-time PCR cycler (Qiagen, Germany) with fluorescence excitation at 470 nm and fluorescence detection at 510 nm ...
-
bioRxiv - Molecular Biology 2021Quote: ... SYBR I was added to the samples after the reaction was completed and the fluorescence measured in a Real-time PCR machine (Rotor-Gene Q, Qiagen, USA). Triplicates for each conditions were measured and the mean value calculated ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time PCR was monitored on Rotor-Gene® Q-Pure Detection System (Software Ver. 2, Qiagen Inc., Valencia, CA, USA) and performed using QuantiFast SYBR® Green PCR Master Mix (Qiagen) ...