Labshake search
Citations for Qiagen :
401 - 450 of 10000+ citations for Human Gastrin Cholecystokinin Type B Receptor CCKBR ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... serially diluted matching human PCR amplicons cloned into the pDrive vector (Qiagen) were used to generate a standard curve ...
-
bioRxiv - Biochemistry 2020Quote: ... resuspended in buffer A supplemented with 8 M guanidine hydrochloride (= buffer B) and loaded onto an Ni-NTA agarose column (QIAGEN) pre-equilibrated in the same buffer ...
-
bioRxiv - Immunology 2020Quote: ... b is the intercept-y of the standard curve and m is the slope of the standard curve (QIAGEN, 2014). Subsequently ...
-
Intrarenal B cells integrate in situ innate and adaptive immunity in human renal allograft rejectionbioRxiv - Immunology 2020Quote: ... and CD45+ Calcein+ DAPI-CD19+ CD38+ activated B cells were single-cell sorted into 96-well plates with catching buffer (RLT lysis buffer (Qiagen) with 1% 2-mercaptoethanol (Sigma-Aldrich)) ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to 2 ml lysis matrix B tubes (MPBio) and subjected to bead beating for 15 min at 30 Hz (Tissuelyser II, Qiagen) with RNAse A added ...
-
bioRxiv - Immunology 2024Quote: ... of either the B cell clone or polyclonal B cells of the patients were directly FACS sorted into 100µL ALT lysis buffer (Qiagen MicroKit). gDNA was extracted as per manufacturer’s instructions (Qiagen MicroKit) ...
-
bioRxiv - Immunology 2023Quote: Aliquots of ∼500,000 isolated B cells were pelleted at 400g for 5 minutes and then resuspended in 350uL RLT Plus buffer (Qiagen). Total RNA was then isolated using RNeasy Mini Plus kit (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... was used to amplify species specific 16S rRNA genes in order to identify and to quantify the relative abundance of 45 types of gut microbiota according to the manufacturer’s instructions (Qiagen, Hilden Germany) (Supplementary table 1) ...
-
bioRxiv - Cell Biology 2019Quote: ... KEN-Cyclin B1-GFP/mCherry-α-tubulin and GFP-Aurora B/WT-Cyclin B1-mCherry stable cell lines were established using Effectene (Qiagen) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: ... or remaining mosquito bodies were collected separately in a 2ml Eppendorf Safe Lock tube with 250μl DMEM (2% FBS, 1% Sodium Pyruvate) with 25 mg/ml Amphotericin B and a stainless steel bead (Qiagen, Hilden, Germany). Samples were stored at −80°C.
-
bioRxiv - Immunology 2020Quote: ... Single CD3-CD8-CD14- CD16- CD20+CD38+ BG505 SOSIP+YU2-gp140+ B cells were sorted into individual wells of a 96-well plates containing 5 μl of a lysis buffer (Qiagen, 1031576) per well using a FACS Aria III (Becton Dickinson) ...
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: Cytokine secretion assays were performed using Human Multi-Analyte ELISArray plate (Qiagen CMEH6321A). IL1β ...
-
bioRxiv - Pathology 2019Quote: Total RNA of human podocytes was extracted per manufacturer’s instructions (Qiagen, Germantown, MD) and 1 μg RNA was used for cDNA synthesis (Transcriptor first strand cDNA synthesis kit ...
-
bioRxiv - Genomics 2019Quote: We analyzed human and mouse Tug1 cDNA sequences with CLC Genomics Workbench (Qiagen) for open reading frames (ORFs) ...
-
bioRxiv - Neuroscience 2022Quote: ... using commercially available primers for human FAAH (CpG Island 100530) (EPHS100530-1A, Qiagen). Methylation-sensitive (EPHS115450-1A ...
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...
-
bioRxiv - Genetics 2023Quote: ... amplifications were performed in reaction volumes of 25 μL using a reaction mix containing 1x Type-it Multiplex PCR Master Mix (Qiagen, Gmbh, Hilden), 0.2 μM of each forward and reverse primer pair ...
-
bioRxiv - Genomics 2024Quote: ... the Qiagen RNeasy Mini Kit was used according to Qiagen RNA Protect Reagent Handbook Protocols 4 and 7 with Appendix B on-column DNase digestion (Qiagen, Hilden, Germany). The RNA was assessed with UV-Vis spectrophotometry (Denovix DS-11 ...
-
bioRxiv - Biophysics 2021Quote: ... Small interfering RNAs (siRNAs) targeting human AKR1C1-4 were synthesized by Qiagen (Valencia, CA). HepG2-RC cells (5×106 cells/well ...
-
bioRxiv - Genomics 2022Quote: ... pallidum and human RNase P gene (RNP) using a Rotor-Gene 6000 instrument (Qiagen) as previously described with modifications (11 ...
-
bioRxiv - Neuroscience 2022Quote: Cultured human T cells after treatment were flash frozen in Buffer RLT (Qiagen, 79216) and kept in −80°C until processing ...
-
bioRxiv - Genomics 2019Quote: Dissociated human islets cells were transfected with scramble siRNA (Cat# 1027284, Qiagen, Toronto, Canada) or siRNA from ThermoFisher Scientific against OGDHL (ID# s31422) ...
-
bioRxiv - Genomics 2021Quote: cDNA was generated from 5μg of Human XpressRef Universal Total RNA (Qiagen cat # 338112) using Superscript III Reverse Transcriptase (Invitrogen cat # 18080093 ...
-
bioRxiv - Microbiology 2021Quote: The RTK RNAi library contained siRNAs targeting 56 human RTK genes (Qiagen, Dusseldorf, Germany), which included four different pairs of siRNAs for each gene ...
-
bioRxiv - Neuroscience 2023Quote: Transfected iPSC-OPCs and post-mortem human MS samples were lysed in Qiazol (Qiagen), and RNA was isolated using a standard chloroform extraction and ethanol precipitation method ...
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: Bacterial and human cells were treated with RNAprotect cell or bacterial reagent (Qiagen, Germany) and stored at -80°C for up to 1 week ...
-
bioRxiv - Cell Biology 2023Quote: CD14+ human monocytes were transfected with 200 nM siRNA using the HiPerfect system (Qiagen) as described previously ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Neuroscience 2022Quote: ... human PAAS proteome was imported into Ingenuity Pathway Analysis (IPA) software (QIAGEN, 2020 released version)[84] for canonical pathway analysis ...
-
bioRxiv - Immunology 2023Quote: Human nasal swab samples were inactivated with 350 µls RLT buffer (Qiagen, Cat No. 79216) containing 1% β-mercaptoethanol for a minimum of 10 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... The autophagy screening was performed using the RT2 Profiler™ PCR Array Human Autophagy (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Genomics 2019Quote: The RNA extraction kit (RNeasy Mini Kit, Qiagen) was used for the total RNA isolation ...
-
bioRxiv - Bioengineering 2020Quote: ... An RNA extraction kit (RNeasy extraction Kit, Qiagen) was used to purify RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription kits (RT2 First Strand Kit; Qiagen) were used for cDNA synthesis ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using miRCURY LNA miRNA Human Panel I according to manufacturer’s instructions (Exiqon/Qiagen). The data was analyzed using GenEX software (MultiD ...
-
bioRxiv - Immunology 2021Quote: Pathway-specific primer mixes (Rat Antibacterial Response, PBR-148Z, and Human Antibacterial Response, PBH-148Z; Qiagen) were used for preamplification and qPCR arrays (Rat Antibacterial Response ...
-
bioRxiv - Molecular Biology 2021Quote: HeLa cells were transfected with 40 nM specific human RBM10-siRNA5 or control AllStar siRNA (Qiagen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: Human cancer stem cells RT2 Profiler PCR arrays were purchased from Qiagen (Cat# PAHS-176ZA-12) and used in combination with a 7900 HT real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... while rodent and human samples were eluted in 100 µl of buffer AE (Qiagen, Hilden, Germany). Samples were stored at −20°C before PCR.
-
bioRxiv - Developmental Biology 2021Quote: ... Targets were included if biochemically confirmed using human tissue or non-species methods (sourced from QIAGEN’s curated Ingenuity Knowledge Base ...
-
bioRxiv - Immunology 2020Quote: ... RNA was extracted from purified human T cells using the RNeasy Plus Minikit (Qiagen, Germantown, MD). 0.5 μg Donor B RNA was mixed with 4.5 μg Donor A RNA to create sample C for quantitation experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... and human induced astrocytes (>day 30 of differentiation) were harvested in RLTplus Lysis buffer (Qiagen, 1053393). Total RNA was isolated using the RNeasy micro/mini plus kit (Qiagen ...
-
bioRxiv - Genetics 2024Quote: ... and aligned to a human reference sequence GRCh38/hg38 by using CLC Genomics Workbench v20 (Qiagen). The TPM (transcript per million ...