Labshake search
Citations for Qiagen :
401 - 450 of 10000+ citations for Human Apelin APLN CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Investigation of the cell cycle related genes in LoVo cell line on treatment with FA FOS I was performed as described above by using the synchronized and 24 h FA FOS I (198 µg/ml) treated cells profiled by using RT2 Prolifer PCR Array- Human Cell cycle from Qiagen. The data was analysed by using Gene globe platform and reactome pathway analysis.
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cell Biology 2024Quote: ... The melting curves of amplified product DNA fragments were quantified against the methylation standard curve generated using commercial bisulfite converted human genomic DNAs (Qiagen) and expressed as a mean methylation percentage.
-
bioRxiv - Microbiology 2024Quote: ... with ReadyMade PrimeTime primers for SPI1 (Integrated DNA Technologies Inc, USA) and RT2 qPCR Primer Assay for Human GAPDH (cat# PPH00150F-200, Qiagen). Expression was quantified using ABI Sequence Detection software compared to serial dilutions of an SPI1 or GAPDH synthetic sequence gBlock (Integrated DNA Technologies Inc ...
-
bioRxiv - Molecular Biology 2021Quote: ... The specific bands were purified using gel purification kit (Qiagen gel purification kit). All these DNA amplified products were γ-32P radiolabelled by using T4 polynucleotide kinase enzyme using [γ-32P] ATP as the substrate with the reaction condition of 37°C for 30 min followed by 65°C for 25min enzyme inactivation period ...
-
bioRxiv - Bioengineering 2019Quote: ... Total RNA extraction was performed using a standard kit (RNeasy mini kit, Qiagen). RNA concentration was quantified (ND-1000 ...
-
bioRxiv - Bioengineering 2020Quote: ... DNA was extracted using a commercially available kit (Qiagen DNeasy Blood & Tissue Kit). Afterwards ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... RNA was extracted using a commercial kit (RNeasy Micro kit, Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... DNA was extracted using a commercial kit (Qiagen Buccal Cell and DNAeasy Kit), as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and using the RNeasy Mini kit and the RNAase free DNAase kit (Qiagen). After RNA extraction ...
-
bioRxiv - Microbiology 2020Quote: We used the DNeasy PowerWater Kit and the DNeasy PowerSoil Kit (Qiagen, Germany) according to the manufacturer’s instructions to extract DNA from the water and soil samples ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated using RNeasy Micro Kit or RNeasy Mini Kit (Qiagen). After initial quality control using Agilent’s Bioanalyzer sequencing libraries were prepared from 500ng of total RNA per sample following Roche’s “KAPA stranded mRNA Seq” library preparation protocol for single indexed Illumina libraries ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA was isolated with RNeasy Micro Kit or RNeasy Mini Kit (Qiagen). cDNA was synthesized using 1μg of mRNA with SuperScript™ III Reverse Transcriptase (Invitrogen 18080044) ...
-
bioRxiv - Neuroscience 2021Quote: ... Bacterial DNA was extracted using a specific kit (QIAamp Powerfecal DNA kit, Qiagen), and its concentration was quantified by Nanodrop 2000 C Spectrophotometer (ThermoFisher Scientific).
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated using RNeasy Mini kit or RNeasy Micro kit (QIAGEN). cDNA was synthesized with Oligo(dT ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid DNAs were purified using QIAfilter Plasmid kits (Midi pre kit, Qiagen #12243) following manufacturer protocol ...
-
bioRxiv - Genetics 2023Quote: Total genomic DNA was extracted using a commercial kit (DNeasy Tissue Kit, QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA was isolated via commercially available kit (Qiagen, RNeasy Mini Kit Cat# 74104) by lysing the cells in the vessel as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Resulting RNA was purified using a spin-column kit (RNeasy mini kit, QIAGEN) and 120 pmol of sgRNA were complexed with 100 pmol of recombinant SpCas9 protein at RT for 20 minutes ...
-
bioRxiv - Microbiology 2023Quote: RNAs were isolated using the RNeasy mini kit mirVana RNA isolation kit (Qiagen). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA was extracted using a commercially available kit (QIAGEN RNeasy mini kit). RNA was stored at −80°C until submission to the University of Minnesota Genomics Center (UMGC).
-
bioRxiv - Physiology 2023Quote: ... Total RNA was isolated with an RNA purification kit (Qiagen miRNeasy mini kit) and DNase treatment to remove DNA contamination.
-
bioRxiv - Evolutionary Biology 2024Quote: High molecular DNA was extracted using the kit MagAttract HMW DNA kit (Qiagen) following manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was extracted using the RNeasy Mini Kit or RNeasy Micro Kit (Qiagen) with on-column DNase digest ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted using a commercial kit (QIAamp Mini Kit, Qiagen, Valencia, CA, USA) on a robotic system ...
-
bioRxiv - Cancer Biology 2019Quote: ... miRNeasy Mini Kit and RNeasy MinElute Cleanup Kit were obtained from Qiagen (Hilden, Germany). GeneChip™ miRNA 3.1 Array Strip ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated using the RNeasy mini kit or the RNeasy micro kit (Qiagen), depending on the number of cells ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was isolated using RNeasy mini kit or RNeasy Micro kit (Qiagen, Germantown, MD) followed by reverse transcription using qScript cDNA Synthesis Kit (QuantaBio ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Total RNA extraction kit (RNeasy mini protection kit) was supplied by Qiagen (Valenica, CA). Antibodies against ASTIV (12 ...
-
bioRxiv - Cancer Biology 2021Quote: DNA extraction was done with a commercial kit (QIAamp® micro Kit, QIAGEN®) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA was extracted using the DNeasy 96 Plant Kit or DNeasyPlant Mini Kit (Qiagen) following the manufacturer’s protocol and eluted in 100 μL of TE buffer (Qiagen).
-
bioRxiv - Molecular Biology 2019Quote: ... QIAGEN plasmid kits and QIAamp fast DNA stool mini kits were purchased from Qiagen Co. ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from organoids by RNAeasy Mini Kit or Micro Kit (Qiagen) and cDNA generated with PrimeScript RT reagent Kit (Perfect Real Time ...
-
bioRxiv - Genetics 2019Quote: ... Samples were first processed with a column-based kit (RNeasy Mini kit, Qiagen, UK), including the optional on-column DNAseI digestion ...
-
bioRxiv - Evolutionary Biology 2021Quote: All DNA was extracted using the Qiagen puregene kit A DNA isolation kits (Qiagen). For D ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA was extracted and purified with RNeasy Micro Kit or RNeasy Mini Kit (Qiagen). In all the experiments except for Fig ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the DNeasy Plant Mini Kit or a DNeasy 96 Plant Kit (Qiagen, Hilden, Germany). Genomic DNA was sheared to an average fragment size of 400 bp using a Covaris M220 ultrasonicator (Covaris ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and purified using a commercial kit (QiAquick PCR purification kit, QiaGen, Germantown, MD, USA). A PCR amplification step was performed using P1 and P2 as primers with 14 cycles (98C for 30 s ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA isolation was performed using RNeasy Mini Kit and RNeasy Micro Kit (Qiagen) respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... which were purified using a PCR cleanup kit (QIAGEN QIAquick PCR purification kit #28104). Reverse primers included a promoter for in vitro transcription using SP6 RNA polymerase (Roche RPOLSP6RO ...
-
bioRxiv - Physiology 2023Quote: ... and extracted for RNA using commercial kits (RNeasy fibrous tissue kit, Qiagen, Valencia, CA). The manufacturer-supplied protocol was modified to include a second round of DNase I treatment in solution to ensure no genomic contamination ...
-
bioRxiv - Plant Biology 2023Quote: ... In short: a commercial DNA extraction kit (DNeasy PowerSoil Pro Kit, Qiagen, Hilden, Germany) was used for extracting DNA from the dried soil and the samples were barcoded with the “Native Barcoding kit” (Oxford Nanopore Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... three kits were used: (1) Qiagen DNeasy Blood & Tissue Kits (Qiagen, cat. no. 69504) for DNA extraction and (2 ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was extracted using RNeasy mini kits or RNeasy Lipid Tissue Mini Kits (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Total mRNA was isolated from 5×105 cells using a kit (RNeasy kit, QIAGEN) and reverse-transcribed using oligo(dT)20 primer (SuperscriptIII ...
-
bioRxiv - Microbiology 2023Quote: ... Blood Genomic DNA Extraction® Kit (Canvax) and DNeasy Power Waste® Kit (Qiagen). In addition ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated using the RNeasy Mini Kit together with the Qiashredder Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2020Quote: ... A Qiagen RT2 SYBR Green master mix with validated qPCR human primers (for HUVECs and BeWo) or mouse primers (for N27 cells) from Qiagen (Frederick) were used to determine relative magnitudes of gene-expression levels using RT-PCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Developmental Biology 2021Quote: ... The expression levels of the mRNAs were quantified using Human Embryonic Stem Cell RT2 Profile™ PCR Array (Cat. PAHS-081, Qiagen) and RT2 SYBR Green qPCR Master Mix (Cat ...