Labshake search
Citations for Qiagen :
401 - 450 of 10000+ citations for Human Aflatoxin B1 Aldehyde Reductase Member 3 AKR7A3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...
-
bioRxiv - Microbiology 2023Quote: Human Inflammatory Response & Autoimmunity Focus) (Qiagen, YAHS-205Z) were used for each of the different samples ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng of cDNA was used for qPCR with the Human Cellular Senescence and Human Aging RT2 Profiler™ PCR Arrays (Qiagen). Arrays were run on the 7300 Real Time PCR System (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: Hepatic gene expression was investigated using qPCR arrays designed for human (RT2 Profiler PCR arrays – ‘Human Fatty Liver’, Qiagen France SAS). Then ...
-
bioRxiv - Microbiology 2023Quote: ... and homogenised with 3-5 mm steel beads in a TissueLyser II (Qiagen, 24 Hz, 2 × 3 min). 350 μL lysed blood or 200 μL lysed head kidney were transferred to a Magna Pure 96 Processing Cartridge (Roche) ...
-
bioRxiv - Genomics 2021Quote: ... PI-negative fraction was sorted in each well of a 96 well plate containing 3 μL of PBS (Qiagen, REPLI-g SC Kit) with 0.2% Tween 20 ...
-
bioRxiv - Genetics 2019Quote: ... cfDNA was extracted from 2 mL of plasma at baseline and from 3 mL of plasma post-treatment using QIAamp DNA purification kit (Qiagen, Venlo, the Netherlands) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... The miRNAs were modified by polyadenylation at the 3’ end and then reverse transcribed into the cDNA of miRNA using the miScript PCR Starter Kit (#218193, Qiagen, Valencia, CA, USA) with an oligo dT primer (with a universal tag) ...
-
bioRxiv - Developmental Biology 2020Quote: ... rhesus fibroblast cell line (n=1), pri-CTB (n=1, rh090419) and TSCs (n=3 rh121118, rh052318, cy091318) using a FlexiGene DNA Kit (Qiagen, cat no: 51206) and quantified using a Nanodrop™ One Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: ... and sunflower_KTI _R (5’ – CTACTCAGATTGAACAGAAGCCAC- 3’were designed and used in a PCR reaction with total DNA extracted (DNeasy Plant Mini Kit, Qiagen, Valencia CA USA) from sunflower leaf tissue ...
-
bioRxiv - Plant Biology 2021Quote: RNA samples were isolated from seedlings at each time point with 3 biological replicates using Qiagen Plant RNA extraction kit (Qiagen; catalog no. 74904). A total of 18 cDNA libraries were prepared following the standard BGISEQ-500 RNA sample preparation protocol and sequenced by the DNBseq platform (BGI ...
-
bioRxiv - Genomics 2020Quote: ... DNA was extracted from peripheral blood leukocyte samples from visit 2 or 3 using the Gentra Puregene Blood Kit (Qiagen; Valencia, CA, USA) according to the manufacturer’s instructions (www.qiagen.com ...
-
bioRxiv - Microbiology 2022Quote: Total mouse lung RNA was extracted at days 0 and 3 post-challenge using the RNeasy Mini Kit as described above (QIAGEN, Cat. No 74004) and purified with the QIAquick PCR Purification Kit (QIAGEN ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5μl of diluted cDNA (1:3 - nuclease-free water) was used as template in 10μl real-time PCR reactions (Qiagen: ‘SYBR Green PCR kit’) to assay specific transcripts (BioRad ...
-
bioRxiv - Cancer Biology 2023Quote: ... The resultant backbone without the Puromycin gene was purified using the QIAquick PCR & Gel Cleanup Kit (Qiagen 28506. A DNA block (Table 3) containing the Blasticidin resistance gene sequence was synthetised (Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: Ni-NTA agarose beads (Qiagen 70666-3)
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... template switching (5’- AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3’, Qiagen), and ISPCR (5’-AAGCAGTGGTATCAACGCAGAGT-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349, Qiagen), and bL36m siRNA 5’-CGGTGGTACGTCTACTGTAAA-3’ (SI04156299 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL11m siRNA 5’-AGGAAGGAGGTCACACCAATA-3’ (SI04135684, Qiagen), mL65 siRNA 5’CAAGCUAUGUAUCAAGGAUtt3’ (s21375 ...
-
bioRxiv - Cell Biology 2023Quote: ... uL16m siRNA: 5’ TACGGAGTTTACAGAAGGCAA-3’ (SI00648291, Qiagen) and Negative control siRNA (SI03650318 ...
-
bioRxiv - Cell Biology 2023Quote: ... MRPL45 siRNA: 5’-CTGGAGTATGTTGTATTCGAA-3’ (SI00649005, Qiagen), bL27m siRNA 5’CAGGCAGACGCCAAGGCATTA-3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647, Qiagen), uL16m siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...
-
bioRxiv - Cell Biology 2023Quote: ... bL31m siRNA 5’-CCAGGCTTATGCACGACTCTA-3’ (SI00649271, Qiagen), mL64 siRNA 5’-AAGAACGCGAATGGTACCCGA-3’ (SI02652349 ...
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Cancer Biology 2024Quote: ... Targeted knockdown was conducted with 100nM ON-TARGETplus smartpool human c-MYC (mixture of 4 individual siRNA) and/or human KLF6-SV1 siRNA (Dharmacon, Lafayette, CO) with HiPerfect (Qiagen, Valencia, CA).
-
bioRxiv - Cell Biology 2021Quote: Oligonucleotides for siRNA included: human βPix (synthesized by Qiagen), human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Genomics 2019Quote: DNA from EndoC-βH1 cells exposed or not to IL-1β and IFN-γ for 48h as described above (3 replicates per condition) was extracted using QIAamp DNA Mini kit (Qiagen, Venlo, The Netherlands). 1 μg DNA aliquots (n=3 ...
-
bioRxiv - Plant Biology 2022Quote: RNA samples were isolated from seedlings at each time point with 3 biological replicates using Qiagen Plant RNA extraction kit (Qiagen, Germany; Cat. No. 74904). A total of 18 cDNA libraries were prepared following the standard BGISEQ-500 RNA sample preparation protocol and sequenced by the DNBseq platform (BGI ...
-
bioRxiv - Neuroscience 2023Quote: ... Dissociated microvascular cells were stained for flow cytometric analysis or were additionally processed with myelin removal beads (Miltenyi 130-069-731) and 3 sequential positive selections with CD31 microbeads (Miltenyi 130-097-418) for RNA isolation (Qiagen RNeasy Micro Kit 74004). cDNA library preparation used Oligo-dT at 60 million clusters/sample (University of Chicago Genomics Facility).
-
bioRxiv - Immunology 2020Quote: ... ConM-SOSIP.v7 carrying a C-terminal His-tag (diluted to 6.5nM in TBS) was immobilized onto 96-well Ni-NTA ELISA plates (Qiagen) by incubation for 2 hours at room temperature after which the plates were washed 3 times with TBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Immunology 2021Quote: ... from P0 Tbx1LacZ/+Crkl+/- (n=3) and their wildtype littermates (n=3) were sorted and fixed using RNAprotect Cell Reagent (Qiagen) for storage before sample submission to the Oxford Genomics Centre ...
-
bioRxiv - Microbiology 2021Quote: ... samples were thawed and homogenized with a single 3 mm Eliminase washed stainless steel ball bearing in for 3 min at 30 Hz (TissueLyser II, Qiagen) then purified by the Direct-zol RNA microprep kit (Zymo).
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Cell Biology 2021Quote: To extract RNA from dissected aorta from amotl2ec+/ec+ (n=3) and amotl2ec-/ec- mice (n=3) was immersed in TRIzol and homogenised by TissueLyser (Qiagen) in TRIzol ...
-
bioRxiv - Plant Biology 2023Quote: ... Arabidopsis thaliana frozen leaf tissues were weighed and ground by using two 3 mm stainless steel beads for 3 minutes at 30 Hz with frozen adapters on a TissueLyser II (Qiagen). The resulting frozen powder was dissolved in 650 µL chloroform-methanol (3:7 ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were flash-frozen in liquid nitrogen immediately prior to grinding and ground using 3 mm glass beads at 30 Hz for 3 min in a TissueLyser II (Qiagen) to a fine powder ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 3 ml RNAprotect Bacteria Reagent (Qiagen), divided into 3 × 1 ml aliquots (3 technical replicates) ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’; Qiagen, Microsynth), si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’ ...