Labshake search
Citations for Qiagen :
401 - 450 of 2752 citations for 7 Bromo 2H 1 3 benzodioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... for 2.5-3 minutes at 30 Hz using TissueLyzer II (Qiagen). Total RNA was extracted from the lysate using NucleoSpin RNA Set for NucleoZOL (Macherey-Nagel ...
-
bioRxiv - Neuroscience 2020Quote: ... siRNAs targeting the 3’UTR of Arhgap11a were purchased (siRNAflex, Qiagen).
-
bioRxiv - Molecular Biology 2019Quote: ... Ligated RNA was purified by adding 3× volume Buffer RLT (Qiagen) and 0.85× volume ethanol ...
-
bioRxiv - Bioengineering 2019Quote: ... size-selected using a 3% agarose EGel EX (Life Technologies, Qiagen), and purified using MinElute Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant was incubated with 3 ml Ni-NTA resins (QIAGEN) with gentle agitation at 4 °C for an hour ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antisense LNA GapmeRs (custom designed, 3’-FAM-labeled, Qiagen, Table S5) were bilaterally microinfused using a 2 μl calibrated micropipette (Hamilton syringes ga 25/70mm/pst3) ...
-
bioRxiv - Bioengineering 2023Quote: ... containing 3 μL 4X Probe PCR Master Mix (250102, Qiagen, USA) (final concentration 1X) ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated with 3 mL Ni-NTA agarose (Qiagen) pre-equilibrated with binding buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Bioengineering 2020Quote: ... and samples with RNA Intergrity Number (RIN) >7 were used for downstream cDNA conversion with RT2 first-strand kit (Qiagen GmbH, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 68°C for 60 s and a final extension cycle of 68°C for 7 min. Amplified PCR products (approx. 429 bp for P gene) were gel purified using QIAquick gel extraction kit (QIAGEN, Hilden, Germany) and sequenced using BigDye Terminator v3.1 Cycling Sequencing Kit (Applied Biosystems ...
-
Cell-free DNA as a biomarker for prostate cancer: elevated concentration and decreased fragment sizebioRxiv - Cancer Biology 2020Quote: ... DNA was extracted from 7 to 55 mL of plasma using the Qiagen QIAamp Circulating Nucleic Acid Kit (Qiagen, Redwood City, CA), and double eluted with 40 μL of Qiagen Elution Buffer ...
-
bioRxiv - Microbiology 2020Quote: The amino acid sequences of FPV184 orthologues from each genera of chordopoxviruses were subjected to multiple alignments (Fig. 5a & Supplementary Fig. S5) using CLC workbench 7 (CLC Bio, Qiagen, Aarhus, Denmark). Protein sequence accession numbers for the indicated viruses are as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... total RNA was extracted from prefrontal cortex (PFC) of male mice at 7 weeks with the AllPrep DNA/RNA Mini Kit (#80204, Qiagen, Hilden, Germany) according to the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: MIEV-or PKCα-KR-transduced HSPCs were co-cultured on OP9 cells in the presence of IL-7 for 17-23 days (late co-culture) and total RNA was isolated using an RNeasy kit (Qiagen, Manchester, UK) from five independent co-cultures ...
-
bioRxiv - Bioengineering 2023Quote: Total RNA of osteogenically differentiated pre-osteoblasts at days 7 and 14 were extracted by RNeasy Plus Mini Kit (Qiagen Inc., USA). RT-qPCR was performed to confirm osteogenic gene expression levels by using TaqMan gene expression assays with the following probe/primer combinations ...
-
bioRxiv - Microbiology 2023Quote: The amino acid sequences of coronavirus spike orthologues were subjected to multiple alignment using CLC Workbench 7 (CLC Bio, Qiagen, Aarhus, Denmark). Protein sequence NCBI reference sequences for the indicated viruses are as follows ...
-
bioRxiv - Genomics 2024Quote: ... the Qiagen RNeasy Mini Kit was used according to Qiagen RNA Protect Reagent Handbook Protocols 4 and 7 with Appendix B on-column DNase digestion (Qiagen, Hilden, Germany). The RNA was assessed with UV-Vis spectrophotometry (Denovix DS-11 ...
-
bioRxiv - Molecular Biology 2020Quote: Whole blood samples from 10 healthy volunteers (n = 5 females and n = 5 males) aged from 25 to 37 were collected into PAX gene RNA blood tubes (Qiagen). Total RNA samples were isolated using QIAcube automation with the PAXgene Blood miRNA Kit (Qiagen ...
-
bioRxiv - Immunology 2019Quote: ... total RNA (2.5-5 μg) was extracted from BM mononuclear cells obtained by Ficoll-Paque gradient centrifugation using the miRNeasy kit (Qiagen) and depleted of ribosomal-RNA (Ribo-Zero™ rRNA Removal Kit ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCGTCATCAGGATTGGCAA and probe 5’-TGGGTGTCTGCTTTGGAACA were used in a one-step qRT-PCR reaction with either Quantifast reagents (Qiagen) for tissue RNA or LightCycler 480 RNA Master Hydrolysis Probes (Roche ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... total DNA was extracted from males (N = 5) and females (N = 5) of each genotype using the DNeasy Blood & Tissue kit following manufacturer protocol (Qiagen). Illumina libraries were prepared using the Nextera DNA Flex Library Preparation Kit (Illumina) ...
-
bioRxiv - Immunology 2024Quote: ... and brain) homogenates collected from mice at 5 dpi and 5 dpc were generated using the Tissue Lyzer II (Qiagen). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... An 80 μL sample of the supernatant was transferred to a new tube and incubated with 5 μL of 5 mg/mL Proteinase K (QIAGEN) for 1 h at 60°C ...
-
bioRxiv - Microbiology 2019Quote: ... 5-10 μg RNA was DNAse treated (Qiagen) and rRNA was depleted (MICROBExpress ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 mm diameter stainless steel beads (QIAGEN) were added to each sample pool ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... and 5-mm stainless-steel beads (Qiagen #69989) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL Proteinase K (20 mg/mL, Qiagen) and 100 µl 10% SDS (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... in 5-ml polypropylene columns (no. 34964; Qiagen), washed with 50 mM Na2HCO3 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and 5-mm stainless steel beads (Qiagen #69989). RNA purification was performed using the NucleoSpin RNA kit (Macherey-Nagel ...
-
bioRxiv - Microbiology 2021Quote: ... in a 5 ml tube (Qiagen, DNAse/RNAsefree). The sediment samples were kept at 4 °C until the next day and then stored at −80 °C ...
-
bioRxiv - Immunology 2020Quote: ... 5×106 PBMCs were resuspended in RLT (Qiagen) and incubated at room temperature for 10 min prior to storage at –80°C ...
-
bioRxiv - Physiology 2020Quote: ... with 5 mm beads in RLT buffer (Qiagen) containing 1% β-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... + 5% beta-mercaptoethanol using a bead mill (Qiagen). Samples were heated at 95° for 5 minutes to denature proteins ...
-
bioRxiv - Microbiology 2022Quote: ... containing 5 mm diameter stainless steel beads (Qiagen) and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of 2U/μL Turbo DNase (Qiagen), and 1 μL of 10 mg/mL RNase A (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM primers and 1 μl DNA template ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 5 μl of Multiplex PCR Master Mix (Qiagen), 0.2 μl of 2 μM Primer and 1 μl DNA template ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl Polyfect Transfection Reagent (Qiagen, catalog # 301105) was added ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 mm stainless steel beads (Qiagen, #69989). Lysates were incubated for 2 h at 37°C protected from light ...
-
bioRxiv - Microbiology 2021Quote: ... 20–30 mg of tissue was taken and placed into a 2 mL tube with 600 µL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Pathology 2021Quote: ... 20 – 30 mg of tissue were placed into a 2 ml tube with 600 µl of RLT buffer with 1% β-mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Valencia, CA; #69989). Tissues were then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... placed into a 2 mL tube with 600 μL of RLT buffer with 1% β–mercaptoethanol and a 5 mm stainless steel bead (Qiagen, Hilden, Germany: #69989), then dissociated using a Qiagen TissueLyser II (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was performed using SYBR green based detection in a Biorad thermal cycler with MiRCURY LNA-based small RNA probes designed against 5’end of tRNA ArgCCT-2 (5‘GCCCCAGUGGCCUAAUGGAUAAGGCACUGGCC3’) with a polyA tail directed reverse miRCURY primer (Qiagen # 339317). U6 was used as an internal control (Qiagen # 339306).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... The supernatant was loaded over 3 ml of Ni-NTA beads (Qiagen) equilibrated in lysis buffer ...
-
bioRxiv - Immunology 2019Quote: ... and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH; all primers from Qiagen).
-
bioRxiv - Evolutionary Biology 2019Quote: ... An additional bead-beating step using 3 mm carbide beads (Qiagen, UK) in a Qiagen tissue lyzer (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against 3’UTR sequence of mouse Alr were purchased from Qiagen. siRNAs were transfected into HEK293 or MEF using Dharmafect 1 Transfection Reagent (Dharmacon) ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...