Labshake search
Citations for Qiagen :
401 - 450 of 2963 citations for 6H 1 3 5 Trioxepino 6 7 f benzimidazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... suspended in 1 mL of (v/v) 50% ACN and homogenized in a bead mill (50 Hz, 5 min; TissueLyser LT, Qiagen, Germany) using two 5 mm tungsten balls ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Cancer Biology 2021Quote: We performed siRNA mediated KD of endogenous FOXA1 from MCF-7 cells stably expressing either pEF1neo-V5 or pEF1neo-FOXA1-V5 using custom synthesized siFOXA1 from Qiagen. The siRNA sequences that target the 3’-UTR of FOXA1 were described in [99] ...
-
bioRxiv - Immunology 2019Quote: Data were analyzed using Microsoft Excel and GraphPad Prism (Graph Pad Software) and visualized using CLC Main Workbench 7 (CLCbio, Qiagen) and DataGraph 3.2 (Visual Data Tools ...
-
bioRxiv - Immunology 2020Quote: ... and DNA from 7-10 clones from before and after FLPo-mediated recombination was prepared by miniprep (Qiagen, cat. 27106) and sequenced by Sanger sequencing with the primer GFP int F Age 66 ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA from plants grown for 7 days after germination in rhizoboxes was extracted with the RNeasy Plant Mini Kit (Qiagen) and first strand cDNA was synthesised with the RevertAid First Strand cDNA synthesis Kit (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... Quality control and de novo assembly of the reads were done using default parameters in CLC Genomics workbench 7 (Qiagen). Whole-genome alignment was performed using Mugsy v1.2.3 (55 ...
-
bioRxiv - Genetics 2021Quote: Total mRNA was isolated from 2 dpf or 7 dpf zebrafish homogenates using the RNeasy Mini Kit (Qiagen, Cat# 74104) and reverse-transcribed with SuperScript VILO (ThermoFisher ...
-
bioRxiv - Developmental Biology 2019Quote: ... Cells with ESC like morphology were picked and 7 clones successfully expanded for genomic DNA isolation using DNeasy Blood and Tissue Kit (Qiagen) followed by genotyping using Taq DNA polymerase (Takara ...
-
bioRxiv - Plant Biology 2021Quote: DNA for bisulfite sequencing was isolated from dissected endosperm at 7 days after pollination using QiaAMP DNA microkit (QIAGEN 56304). Dissected tissue was obtained for two biological replicates for each genotype and incubated overnight in a shaker at 56°C in ATL buffer with Proteinase K ...
-
bioRxiv - Cell Biology 2021Quote: ... These M-cells were resuspended in 500 μl PBS pH 7.2 and mixed with 7 μl BioMag magnetic streptavidin beads (Qiagen, 311714) for 60 min at 4°C and loaded into an acrylic column with curved grade N52 magnet ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from freshly isolated T-cells on day 7 of treatment from spleens using RNeasy Kit (Qiagen). For each group ...
-
bioRxiv - Neuroscience 2023Quote: RNA was isolated from mature wildtype DA neurons following 7-day treatment with GluCer using the RNeasy Micro Kit (QIAGEN) and sent for bulk RNAseq to Azenta ...
-
bioRxiv - Pathology 2023Quote: ... Skeletal muscle (triceps and Tibialis anterior (TA)) and spinal cord tissue samples underwent homogenization with 7 mm stainless steel beads (#69990, Qiagen) in a Tissue Lyser LT (#85600 ...
-
bioRxiv - Immunology 2023Quote: ... The resulting cell suspension was concentrated by centrifugation (7 min, 350 g) and lysed in RLT buffer(Qiagen, cat. 79216) 0.1-0.5 *10^6 lymphocytes /sample density ...
-
bioRxiv - Plant Biology 2024Quote: ... about 20 mg of tissue from 7-day-old seedlings was ground into fine powder in liquid nitrogen with a TissueLyser system (QIAGEN). Total proteins were extracted using denaturing buffer (100 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA from 7 of these patients was extracted from CD138+ cells using the miRNeasy Mini Kit (Qiagen GmbH, Germany) according to the manufacturer’s instruction ...
-
bioRxiv - Immunology 2024Quote: TET2 knockout efficiency was confirmed by isolating genomic DNA from CAR T-cells at Day 7 using the dNeasy Blood & Tissue Kit (Qiagen). PCR of genomic DNA was performed with TET2 Forward Primer 5’-TCCCTGAGTCCCAGTCCATC-3’ and Reverse Primer 5’-TCAGGAATGGCCAGGTTCTG-3’ using MyTaq Red 2X Mix (Meridian Bioscience) ...
-
bioRxiv - Biophysics 2024Quote: ... where the band corresponding to the desired handle length (∼1.6 kb or 1.7 kb for LH and RH respectively) was excised and then the DNA extracted using a gel-extraction kit (Qiagen). The RNA hairpin substrate was then annealed and ligated between the LH and RH handles (see final construct configuration as in Fig ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 6 µM and harvested 24 h later by adding RLT lysis buffer (Qiagen). Similarly ...
-
bioRxiv - Neuroscience 2021Quote: ... tissue from 6 brains were pooled to prepare total RNA (RNEasy micro kit, Qiagen) for reverse transcription and amplification to cDNA (Ovation Pico WTA kit ...
-
bioRxiv - Immunology 2021Quote: ... and harvested for RNA extraction after 6 hours of incubation using RNAeasy kits (Qiagen). cDNA was synthesized from 500 ng of RNA using Quantitect Reverse Transcriptase kits (Qiagen) ...
-
bioRxiv - Genetics 2019Quote: HEK293Ts were plated in 6 well plates and transfected using Effectene Transfection Reagent (Qiagen) according the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... IL −6 and TNFα mRNA were detected by validated QuantiTect primer assays 144 (Qiagen).
-
bioRxiv - Biophysics 2023Quote: TSA measurements were carried out on a Rotor-Gene Q 6 plex (Qiagen, Germany) instrument at a heating rate of 2 °C/min and a temperature range of 25−90 °C in the presence of a CPM dye ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 nM siRNAs were mixed with 6 µl of HiPerFect transfection reagent (Qiagen, #301707) in 100 µl of serum free DMEM and added to freshly plated cells drop by drop ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 µg pINDUCER20-GFP-AFOS using PolyFect (Qiagen, 301107). Media was collected at 48 and 72 hours post-transfection and viral particles were precipitated using PEG-it™ Solution (System Biosciences ...
-
bioRxiv - Plant Biology 2022Quote: ... Hoko-3 using a Genomic-tip kit (Qiagen, Hilden, Germany). Library preparation was performed using SMRTbell Express Template Prep Kit 2.0 (PacBio ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... then lysed 3 times in a pre-cooled TissueLyser (QIAGEN). Proteins were dissolved in lysis buffer (4% SDS ...
-
bioRxiv - Cell Biology 2019Quote: ... Table 3 in the Rotor Gene Q 2plex cycler (Qiagen).
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 3 mL of Ni-NTA resin (Qiagen) for 1.0 h at 4 °C and then applied to a gravity flow column ...
-
bioRxiv - Molecular Biology 2023Quote: ... were crushed with a tungsten carbide bead (3 mm, Qiagen) on a Retsch MM400 mixer mill for 60 seconds at 30 Hz and DNA was extracted using the DNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were homogenized in 1 ml cell culture medium (see above) and a 5 mm steel bead in a TissueLyser (Qiagen, Hilden, Germany). Fecal samples were vortexed in sterile NaCl and the supernatant was sterile filtered (22µm ...
-
bioRxiv - Immunology 2020Quote: YFP+ Treg cells were sorted from spleen and LN of WT or Usp22fl/flFoxp3YFP-Cre mice (n=5 per group) and total RNA was isolated from 1×106 cells per sample using an RNeasy Mini Kit (Qiagen, Cat# 74104) as previously described47 ...
-
bioRxiv - Genetics 2020Quote: ... 30 mg of snap frozen tissues were processed adding 1 ml of QIAzol reagent in presence of one 5 mm stainless steel bead (Qiagen, Hilden, Germany). Total RNA isolation from homogenized tissues was performed using Qiagen RNeasy kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and isolated keratinocytes and fibroblasts from the skin and Wound7 (n = 5/each group) (Table 1 and Table S1) by using the miRNeasy Mini kit (Qiagen, Hilden, Germany) and prepared for library construction ...
-
bioRxiv - Cancer Biology 2023Quote: ... we adapted the same conditions used in Dip-C40 and lysed each nucleus in 150 nL of lysis buffer containing 20 mM Tris pH8/20 mM NaCl/25 mM DTT/0.15% Triton X-100/1 mM EDTA/5 µg/mL Qiagen Protease (Qiagen, cat. no. 19157). After dispensing ...
-
bioRxiv - Immunology 2024Quote: Genomic DNA was then isolated from 1-5 million isolated PBMCs using the DNeasy Blood and Tissue kit (Qiagen; Cat. No. 69504) following manufacturer instructions ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...