Labshake search
Citations for Qiagen :
401 - 450 of 3601 citations for 6 Bromo N tert butyl 2 4 chlorophenyl imidazo 1 2 a pyridin 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 6 (Qiagen) for additional analysis ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Plant Biology 2024Quote: ... 3-4 plants were pooled and RNA was extracted using the RNeasy plant mini kit (Qiagen). 100 ng of total RNA per sample determined using a Qubit fluorometer (Thermofisher) ...
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... Transcripts were stabilized by mixing 3 mL of cell cultures at the mid-log phase with 6 mL of RNAprotect Bacteria Reagent (Qiagen). Samples were immediately vortexed for 5 sec ...
-
bioRxiv - Immunology 2022Quote: ... A549-ORF7a and A549-ORF7b cells were seeded (3×10E5) in 6-well plates and lysed using RLT buffer for RNA isolation (RNeasy mini kit, Qiagen). Each sample was performed in triplicate ...
-
bioRxiv - Evolutionary Biology 2019Quote: DNA from parental and all second-generation hybrid offspring (KonPar: N = 263; PruKoh: N = 193; CerEuk: N = 230) was isolated using the DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA) and sequenced following the Genotype-By-Sequencing (GBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18S rRNA gene was used as internal control for normalization ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ... Real time PCR was performed with 1:2 diluted cDNA using SYBR green detection system (Thermo Fischer Scientific, F415L) and Rotorgene Q (Qiagen, 9001560). 18 S rRNA gene was used as internal control for normalization ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA-SARC-CoV-2 Wuhan-Hu-1 P681H S plasmid was then extracted using the QIAprep Spin Miniprep Kit (Qiagen N.V.) and Sanger sequencing was used to confirm incorporation of the mutation.
-
bioRxiv - Genomics 2022Quote: ... Trachea was dissected and immersed in 1 mL PBS in a 2 mL microcentrifuge tube (Fisherbrand, 14-666-315) containing one stainless steel bead (QIAGEN, 69989). After the homogenization ...
-
rpoB, a promising marker for analyzing the diversity of bacterial communities by amplicon sequencingbioRxiv - Microbiology 2019Quote: ... IJs were crushed by three cycles of mechanical grinding (2 minutes at 30 Hz followed by 1 minute without agitation) in a TissueLyser II apparatus (Qiagen, France). We added 2 µL of Ready-Lyse Lysozyme Solution (Epi-centre ...
-
bioRxiv - Synthetic Biology 2020Quote: ... For SARS-CoV-2 antigen detection the blots were incubated with 1:2000 Anti-His mouse monoclonal primary antibody (Qiagen, #34660) and then incubated with 1:10000 peroxidase labelled anti-mouse IgG secondary antibody (GE Healthcare) ...
-
bioRxiv - Cell Biology 2019Quote: ... MCMBP depleted cells using siRNA and MCMBP-KO (clone #1 and #2) cells was isolated using RNeasy Mini Kit (Qiagen, 74104). The cDNA was synthesized using High-Capacity cDNA Reverse Transcription Kit (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Amplicons were separated on a 1-2% agarose gel and appropriate bands were excised and isolated using a gel extraction kit (Qiagen, USA). These fragments were inserted into the pcDNA3.1-based plasmid or cFUGW lentivirus vector using the T4 ligase (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... or remaining mosquito bodies were collected separately in a 2ml Eppendorf Safe Lock tube with 250μl DMEM (2% FBS, 1% Sodium Pyruvate) with 25 mg/ml Amphotericin B and a stainless steel bead (Qiagen, Hilden, Germany). Samples were stored at −80°C.
-
bioRxiv - Evolutionary Biology 2022Quote: ... log-phase cells in the range of 1–2 × 108 cells using the Qiagen DNeasy® Blood and Tissue kit (Qiagen). We resuspended the genomic DNA in 10 mM Tris-HCl pH 8.5 and stored it at 4° until submission to the McDonnell Genome Institute at Washington University in St ...
-
bioRxiv - Cancer Biology 2023Quote: DNA was extracted from NCI-PC35-1 and NCI-PC35-2 organoids using an AllPrep DNA/RNA Mini Kit (Qiagen 80204) according to the manufacturer’s protocol for animal cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... were homogenised in QIAzol reagent (1 mL) in a 2 mL safe lock tube with stainless steel beads using a TissueLyser II homogeniser (Qiagen, UK) at 30 Hz until fully homogenised (1-2 min) ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA from magnetically purified human NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 4) hiPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen) ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen):cDNA) ...
-
bioRxiv - Immunology 2023Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen): cDNA ...
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix, 5μL of QIAGEN 5x Q-solution and 2 μL of primer mix). A positive control reaction ...
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Generation of cDNA was performed by GoTaq 2-step RT system (Qiagen). Real-time PCR reactions were measured by ABI StepOnePlus system using SYBR green qPCR master mix (ThermoFisher) ...
-
bioRxiv - Microbiology 2019Quote: The Microbial DNA qPCR Array Intestinal Infection 2 kit (Qiagen, Hilden, Germany) (Supplementary table 1 ...
-
bioRxiv - Immunology 2019Quote: ... pelleted and lysed in RLT Plus buffer supplemented with 2-mercaptoethanol (Qiagen). The RNeasy Plus Mini Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tubes were shaken at maximum speed (30) for 2 min (Qiagen Tissuelyser), vortexed ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2-mercaptoethanol and purified using the RNeasy Micro kit (Qiagen).