Labshake search
Citations for Qiagen :
401 - 450 of 2742 citations for 6 Bromo 4 5 dihydro 1H benzo b azepin 2 3H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4C (Qiagen, SI05163977), and 20 nM HIF1A Flexitube GeneSolution siRNA (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 nM siKDM4B (Qiagen, SI00449764), 5 nM siKDM4C (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... siMad2 (5’-CUGAAAGUAACUCAUAAUCUA -3’) (Qiagen). For transfection of the scFv or scFvC plasmids ...
-
bioRxiv - Genetics 2021Quote: ... 5 mM Multiplex-Kit (Qiagen) and HPLC water to a total volume of 10 μL per sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 uL EB buffer (QIAGEN) was added to each well and mixed ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 μl RLT (79216, Qiagen) was added ...
-
bioRxiv - Cancer Biology 2019Quote: RNA from CLL samples and B-cells was isolated by the RNAeasy® Mini kit by Qiagen. cDNA was synthesized using oligo-dT ...
-
bioRxiv - Immunology 2022Quote: Total mRNA was isolated from A20 cells and primary B lymphocytes using a RNeasy Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from MACS-sorted splenic B cells with the RNA Mini Kit (Qiagen, Hilden, Germany). Quantification of RNA was performed with a NanoPhotometer (Implen ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from enriched B cells using the RNeasy Micro Kit (Qiagen, cat no. 74004) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from B-cells or mice tissue using RNA isolation kit (Qiagen, Valencia, CA) and then converted to complementary DNA using TaqMan Reverse Transcription kit (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... total RNA was extracted from the B cells using the RNeasy Mini Kit (Cat. #74004, QIAGEN, Germany) as per the manufacturer’s instruction ...
-
bioRxiv - Immunology 2024Quote: Splenic B cells were stimulated as indicated and RNA was isolated using RNeasy Plus Mini Kit (Qiagen). RT-PCR was carried out as described8 using the following primers ...
-
bioRxiv - Microbiology 2019Quote: ... using a MagAttract PowerMicrobiome DNA/RNA Kit (27500-4 EP/27500-4 EP-BP, Qiagen, Hilden, Germany). Amplicon library preparation and sequencing were done as described previously [35] ...
-
bioRxiv - Microbiology 2020Quote: ... one well per condition was harvested and processed using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s instructions as noted above ...
-
bioRxiv - Molecular Biology 2019Quote: Real-time one-step reverse transcription quantitative PCR was performed with the QuantiTect Virus Kit (Qiagen, Foster City ...
-
bioRxiv - Neuroscience 2022Quote: Total RNAs (small and large RNAs) were extracted in one fraction with miRNeasy FFPE kit (Qiagen) following manufacturer’s protocol with minor changes ...
-
bioRxiv - Cancer Biology 2020Quote: An RNA probe targeting c-myb was generated using one-step RT-PCR (Qiagen, Manchester, UK) using the following primers c=myb-F 5’-CCAAGTCAGGAAAACGCCACCTCG-3’ and c-myb-R 5’-GCTGTTGTTTAGCGGAGTTGGGCT-3’ and cloned into the dual promoter vector pCRII-TOPO (Life Technologies) ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was isolated from NIH3T3 cells using the FastLane Cell One-Step Buffer Set (Qiagen). The mouse embryo brains at E10.5 were dissected in cold PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... One fifth of the total sample was used to purify RNA using miRNeasy kit (QIAGEN, 217004) and to calculate RNA enrichment ...
-
bioRxiv - Physiology 2022Quote: Approximately one-half of the powdered brain was homogenized in 1ml of QIAzol lysis reagent (Qiagen) and RNA was isolated using the Direct-zol RNA Miniprep Plus Kit (Zymo Research) ...
-
bioRxiv - Biochemistry 2022Quote: ... One microgram of total RNA was reverse transcribed into cDNA using QuantiTect Reverse Transcription Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.6 µM each XBP1 specific primers and one-step RT-PCR (QIAGEN OneStep RT-PCR, 210212). The PCR products were analysed by 2% agarose gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... One microgram of DNA was bisulfite-treated using the EpiTect 96 Bisulfite Kit (Qiagen GmbH, Germany). 200 ng of bisulfite-treated DNA was analysed using Infinium HumanMethylation 450K BeadChips (Illumina Inc. ...
-
bioRxiv - Genomics 2019Quote: ... DNA was extracted from leaves of one to two plants using a Qiagen MiniPrep Kit (Qiagen). Genotyping of all lines was performed using a custom lentil exome capture assay as described in Ogutcen et al ...
-
bioRxiv - Microbiology 2020Quote: ... CDNA fragments were amplified with strain-specific primers using the one step RT-PCR kit (Qiagen). Sequencing was performed by Macrogen Europe ...
-
bioRxiv - Developmental Biology 2020Quote: ... Total RNA was isolated from one retina per fish using RNeasy Lipid/Tissue Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... One microgram of purified RNA was converted into cDNA using QuantiTect® Reverse Transcription Kit (Qiagen) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... One µg of genomic DNA was used for bisulfite conversion by using EpiTect Bisulfite Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... we extracted DNA from fresh tissue from one individual using the MagAttract HMW DNA Kit (Qiagen). Prior to library preparation ...
-
bioRxiv - Microbiology 2021Quote: ... All reactions were set up in triplicate using a One-Step RT-PCR kit (Qiagen, UK) as per the following run conditions ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was isolated from one HIP hemisphere by DNeasy Blood & Tissue Kit (Qiagen, catalog # 69504), the DNA quality was first confirmed by Nanodrop (ThermoFisher ...
-
bioRxiv - Genetics 2019Quote: One microgram of total RNA was reverse-transcribed into cDNA using QuantiTect Reverse Transcription Kit (Qiagen). As a control for genomic DNA contamination ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was isolated from one cerebellar hemisphere using the Qiagen miRNeasy Mini kit (Qiagen #217004). On column DNAse digestion (Qiagen #79254 ...
-
bioRxiv - Cancer Biology 2023Quote: RT-PCR was performed on the extracted RNA with One-Step RT-PCR kit (Qiagen, #210212) according to the manufacturer’s instructions and the following conditions ...
-
bioRxiv - Genomics 2023Quote: ... which were merged into one assembly using CLC-Bio Genomics Workbench De Novo Assembly (Qiagen, v11.0.1) with default parameters ...
-
bioRxiv - Genomics 2023Quote: ... and the BioSprint 96 one-for-all Vet Kit utilizing ASL buffer (19082; Qiagen, Germantown, MD) and bead beating ...
-
bioRxiv - Cancer Biology 2023Quote: ... genomic libraries were constructed from adductor muscle DNA from one individual cockle (DNeasy Tissue Kit, Qiagen), from Deep Bay ...
-
bioRxiv - Immunology 2024Quote: ... One μg of RNA was reverse-transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen) containing both oligo-dT and random primers.
-
bioRxiv - Neuroscience 2022Quote: ... Mice received either miRCURY LNA power inhibitor for mmu-miR-335-5p (Ant-335; sequence: 5’-CATTTTTCGTTATTGCTCTTG-3’; Qiagen, Cat No.: 339132; 0.1 nmol in 2 μL PBS), or a non-targeting scrambled control (Scr ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2019Quote: ... B cells from an individual experiment were pooled and used to isolate RNA with RNeasy Mini kit (QIAGEN). After treatment with Ambion Turbo DNase ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was isolated from B cells either using Blood and Tissue or Flexigene kits (Qiagen, Hilden, Germany). DNA was quantified with Qubit (ThermoFisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... SPACA6 concentrated to 7 mg mL−1 in Buffer B was mixed in a 1:1 volumetric ratio (0.3:0.3 mL) with JCSG+ (Qiagen), Cryos (Qiagen) ...
-
bioRxiv - Cancer Biology 2020Quote: RNA was extracted from naïve and cultured B cells using Trizol and RNeasy kit and Dnase treatment (Qiagen) and retro-transcribed to cDNA using random hexamers (Roche ...
-
bioRxiv - Immunology 2020Quote: DAFhi and DAFlo GC B cells (CD19+ CD20+ CD38+ IgD−) were resuspended in RLT cell lysis buffer (Qiagen) after flow cytometric sorting ...
-
bioRxiv - Genetics 2019Quote: DNA was extracted from blood or cell lines using the Puregene Blood Core Kit B (Qiagen, Cat#158467). PCYT1A exons were PCR-amplified from SMD-CRD patient genomic DNA with Accuprime Taq polymerase (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: Total RNA was extracted from FO and MZ B cells using the RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol ...